Aktivirani c-kit receptor u srcu potiče obnavljanje srca i regeneraciju nakon ozljede | stanična smrt i bolest

Aktivirani c-kit receptor u srcu potiče obnavljanje srca i regeneraciju nakon ozljede | stanična smrt i bolest

Anonim

teme

  • Regeneracija srca
  • Kardiovaskularne bolesti
  • Stanična smrt
  • Diferencija matičnih ćelija

Sažetak

Uloga endogene aktivacije c-Kit receptora u homeostazi i popravljanju srčanih stanica ostaje uglavnom neistražena. Generirani su transgeni miševi koji nose mutaciju aktivirajuće točke (TgD814Y) u kinaznoj domeni c-Kit gena. c-Kit TgD814Y receptor bio je izražen u srcu tijekom embrionalnog razvoja i postnatalnog života, u sličnom uzorku vremena i ekspresije kao u endogenom genu, ali ne u hematopoetskom odjeljku koji omogućuje proučavanje srčano specifičnog fenotipa. mutacija c-Kit TgD814Y proizvela je konstitutivni aktivni c-Kit receptor u srčanom tkivu i stanicama transgenih miševa, što je dokazano povećanom fosforilacijom ERK1 / 2 i AKT, koji su glavni nizvodni molekularni efektori signalizacije c-Kit receptora. U odraslih transgenih srca, srčana morfologija, veličina i ukupni c-Kit + broj srčanih stanica nije bio različit u usporedbi s wt miševima. Međutim, kada su miševi c-Kit TgD814Y podvrgnuti transmuralnim nekrotičnim oštećenjima srca krioinjurijom (CI), svi transgeni su preživjeli, u usporedbi s polovinom masnih miševa. U subakutnoj fazi nakon CI transgeni i masni miševi pokazali su slično oštećenje srca. Međutim, 9 dana nakon CI, transgenični miševi pokazali su povećan broj c-Kit + CD31 + endotelnih stanica porijekla koji okružuju nekrotično područje. Naknadnim praćenjem, opaženo je dosljedno smanjenje fibrotičke površine, povećana gustoća kapilara i povećana stopa nadopunjavanja kardiomiocita (utvrđeno BrdU inkorporiranjem) u transgeni u usporedbi s wt miševima. Dosljedno, matične stanice CD45 - c-Kit + koje su izolirane iz transgenih miševa c-Kit TgD814Y pokazale su poboljšani potencijal diferencijacije endotela i kardiomiocita u usporedbi sa stanicama izoliranim iz mas. Konstitutivna aktivacija c-Kit receptora kod miševa povezana je s povećanim srčanim miogenim i vaskularnim reparativnim potencijalom nakon ozljede, uz značajno poboljšanje preživljavanja.

Glavni

c-Kit je receptor za tirozin kinazu neophodan za proliferaciju, preživljavanje i migraciju nekoliko vrsta matičnih stanica poput prekursora melanocita, hematopoetskih i matičnih stanica klija. 1, 2, 3, 4 U novije vrijeme prijavljeno je da se c-Kit receptor eksprimira u matičnim stanicama srca i neurona. 5, 6 Miševi kojima nedostaje c-Kit gen prisutni su u urođenim stanicama i melanocitima i umiru u prvim danima postnatalnog života zbog oštećene hematopoeze. 7, 8 Vezanje c-Kit liganda (KL) inducira receptorsku homodimerizaciju i autofosforilaciju intracelularnih domena tirozin kinaze, što dovodi do modulacije različitih signalnih putova kao što su AKT i MAPK. 9, 10, 11

U posljednjih 15 godina, nekoliko je studija pokazalo da c-Kit + matične stanice srca (CSC) imaju korisne učinke na popravljanje i regeneraciju srca. 12 Genetski mutirani miševi s manjkom c-Kit signalizacije ( W / Wv ) pokazuju pogoršanu srčanu preoblikovanje nakon infarkta miokarda, a obrnuto transgenični miševi koji prekomjerno izražavaju KL u srcu pokazuju poboljšani popravak miokarda u usporedbi sa njihovim wt littermates nakon infarkta miokarda. 13, 14, 15 Pojačana ekspresija KL koja se javlja u ishemičnom srcu pogoduje migraciji c-Kit + dobivenih iz koštane srži i CSC-a aktivacijom p38 MAPK. 16, 17, 18 Nadalje, c-Kit + CSC nedavno su korišteni u liječenju bolesnika s ishemijskom kardiomiopatijom i zatajenjem srca sa značajnim poboljšanjem sistoličke funkcije i smanjenjem veličine infarkta. 19, 20, 21

Iako se c-Kit naširoko koristi kao 'marker površinske stanice' za identificiranje matičnih stanica iz embrionalnog, kao i srca odraslih, 22, 23 malo informacija 14, 15 dostupno je o funkciji koju c-Kit signalizacija ima u aktiviranju CSC u popravku srca.

Da bi se istražila uloga c-Kit-a u popravljanju srca, stvoreni su transgeni miševi koji su mutirali verziju c-Kit gena. Supstitucija tirozina aspartanskom kiselinom 814 u domeni fosfotransferaze dovodi do konstitutivne aktivacije receptora. Smanjeno fibrotičko područje u krio-ozlijeđenim srcima, smanjena upalna mijeloidna stanica u krvi, povećani broj endotelnih stanica c-Kit + CD31 + i kapilara obilježenih izolektinom B4 (IB-4), kao i novootvoreni kardiomiociti pozitivni na BrdU u oštećenom području srca opaženi su transgeni miševi. Aktivacija MAPK i AKT značajno je poboljšana u srcima i CSC-i transgenih miševa, pri čemu dvije kinaze moduliraju aktivaciju i endotelnu / miogenu diferencijaciju CSC-a. Sveukupno, ovi podaci pokazuju da aktivirani c-Kit receptor ima blagotvornu zaštitnu / regenerativnu ulogu za tkivo miokarda nakon ozljede poboljšavajući srčano pregradnja i popravljanje, dok potiče diferencijaciju srčanih staničnih prethodnika vjerojatno zbog aktiviranja signala MAPK i AKT.

Rezultati

Generacija transgenih miševa koji izražavaju aktivirani c-Kit receptor u srcu

Za generiranje transgenih miševa koji izražavaju konstitutivno aktivirani c-Kit receptor, korištena je metoda rekonstitucije bakterijskog umjetnog kromosoma (BAC) koja omogućuje transkripciju c-Kit gena endogenim regulatornim nizovima (Slika 1).

Image

D814Y supstitucija inducira konstitutivnu c-Kit aktivaciju. ( a ) Pojedino lokalno poravnavanje sljedica c-Kit humanih ( Homo sapiens ) i mišjih ( Mus musculus ) c-Kit okruženja navodnih ostataka radi konstitutivne aktivacije u drugoj domeni receptora za kinazu. ( b ) sekvencijalni kromatogram koji prikazuje mutaciju asparaginske kiseline i tirozina uvedenu u c-Kit mišom BAC RP23- 309C11. ( c ) WB i denzitometrija izraza c-Kit na srcima prikupljenim iz embrija u različitim fazama razvoja. Mutantni c-Kit protein eksprimiran je 2, 5 puta više nego endogena razina u c-Kit TgD814Y c-Kit +/− embrionima. ( d ) WB i denzitometrija c-Kit ekspresije na ukupnom srčanom lizatu prikupljenom od novorođenih miševa. Mutantni c-Kit protein eksprimiran je 2, 5 puta više od razine endogenog c-Kit proteina u c-Kit TgD814Y c-Kit +/- miševima. c-Kit aktiviranje je prikazano pan fosfo-tirozin protutijelom koje prepoznaje specifični pojas na visini receptora. ( e ) WB analiza na srcima prikupljenim od 7 dpp miševa. Podaci se dobivaju iz najmanje tri odvojena srca i navode se ± SD; ** P <0, 01, *** P <0, 001. ( f ) Imunofluorescentna analiza c-Kit + stanica (crvena) u izoliranom c-Kit TgD814Y neonatalnim miocitima, kultiviranim 24 h, obojenim s MEF2C (zelena) i MF20 (zelena). Nuklei (plavi) su suprotstavljeni Hoechst 33342. Linija skale 30 μm

Slika pune veličine

U ljudi je nađeno da je 816 aspartanske aminokiseline druge kinazne domene c-Kit supstituirano aktivirajućim mutacijama u nekoliko tumora (slika 1a). 24, 25, 26 Odgovarajući mišji 814 aspartički ostatak je stoga uspješno mutiran na tirozin (D814Y) u mišjem BAC (RP23-309C11) što je potvrđeno analizom sekvenci (slike 1a). Rezultirajući BAC potom se upotrijebio za stvaranje transgenih miševa. Proizvedeno je nekoliko osnivačkih linija, od kojih su dvije (Tg7 i Tg8) prenijele i na sličan način izražavale konstitutivni aktivni c-Kit receptor (c-Kit TgD814Y ).

Transgeni miševi su križani s c-Kit divljim tipom ( c-Kit + / + ) ili c-Kit heterozigotnim ( c-Kit + / - ) miševima. U embrionalnom (Slika 1c) i neonatalnom (Slika 1d i Slika 2b) srca transgenih miševa izrazila je receptor 2, 5 puta više u usporedbi s kontrolnim miševima, što ukazuje da je ekspresija proteina c-Kit TgD814Y bila slična endogenim razinama c-Kit receptora. + / + miševi. U dobi od 1 tjedna, c-Kit receptor može se lako otkriti analizom Western blotting (WB) ukupnih srčanih lizata c-Kit TgD814Y c-Kit +/− miševa, ali ne i sa c-Kit +/− miševa u kojima detektirana je samo imunoprecipitacijom (slika 1e, dopunska slika 1A). Da bi se provjerilo je li uvođenje D814Y mutacije aktiviralo c-Kit receptor, korišteno je protutijelo protiv fosfo-tirozina u WB analizama, što omogućava otkrivanje svih mogućih mjesta autofosforilacije receptora. Slike 1d i e prikazuju povećanu fosforilaciju tirozina u proteinskoj vrpci koja odgovara c-Kit receptoru u transgeničnim srcima u usporedbi s heterozigotnim srcima. Ovi rezultati potvrđeni su u srcima c-Kit TgD814Y c-Kit + / + miševa (Slika 2c i podaci nisu prikazani). Da bi se dodatno karakterizirala ekspresija transgena, izolirane neonatalne srčane stanice iz c-Kit TgD814Y c-Kit +/- miševa dobivene su i uzgajane 24 sata prije bojenja imunofluorescencijom. Slika 1f pokazuje da se c-Kit izražava u miocitnim potomcima, što je otkriveno zajedničkim bojenjem s markerom MEF2C (slika 1f, gornje ploče), ali ne u krajnje diferenciranim miocitima kao što je prikazano bojenjem MF20 (slika 1f, donje ploče). Ovi rezultati pokazuju da ekspresija konstitutivno aktiviranog receptora ne sprečava normalnu diferencijaciju miocita i ne inducira ektopičnu ekspresiju c-Kit u diferenciranim miocitima. Ekspresija i aktiviranje transgenih proteina također su primijećeni u testisima i moždanom tkivu u različitim dobima (dopunska slika 1B). Ovi podaci potvrđuju da se transkripcija gena c-Kit , metodom rekonstitucije BAC-a, odvijala pod endogenim regulatornim mehanizmima u tim tipovima stanica.

Image

MAPK i AKT aktivacija u c-Kit TgD814Y transgeničnim srcima. ( a ) Izolirana su srca i jetra iz c-Kit TgD814Y c-Kit - / - i c-Kit - / - E15.5 i proteinski ekstrakti analizirani na AKT i MAPK fosforilaciju. Fosforilirani supstrati povećani su u embrionalnim srcima transgenih miševa. ( b ) WB analiza proteinskih ekstrakata iz c-Kit TgD814Y c-Kit + / + i c-Kit + / + 3 dpp srca dvije različite životinje. Prijavljena je denzitometrija c-Kit ekspresije, MAPK i AKT fosforilacija. Podaci se navode kao prosjek tri srca ± SD; * P <0, 05, ** P <0, 01, *** P <0, 001. ( c ) Neonatalne srčane stanice izolirane iz c-Kit TgD814Y c-Kit + / + i c-Kit + / + 3 dpp srca su stimulirane sa 100 ng / ml KL u trajanju od 10 minuta, a proteinski ekstrakti su obrađeni za AKT i MAPK fosforilaciju. Izvješćuje se o denzitometriji šest zasebnih pokusa. Podaci su navedeni ± SD; * P <0, 05, ** P <0, 01

Slika pune veličine

Aktivirani c-Kit TgD814Y receptor nije eksprimiran u hematopoetskim odjeljcima

c-Kit nokaut miševi umiru nakon rođenja zbog teškog oštećenja hematopoeze. Mutirani i konstitutivno aktivni protein c-Kit receptora nije detektiran u koštanoj srži odraslih analizama WB i protočne citometrije (dodatne slike 1C i D). To bi moglo odražavati prijavljenu odsutnost ekspresije konstrukcije BAC unutar hematopoetskih stanica koštane srži. 27

Da bismo detaljno proučili ekspresiju c-Kit TgD814Y transgena u hematopoetskim odjeljcima, stvorili smo miševe koji oštećuju c-Kit (c-Kit - / - ; Dopunska slika 1E) i rekonstituirali smo ih s transgenom ( c-Kit TgD814Y c -Kit - / - ). Slično kao c-Kit - / - zametak i novorođenčad, c-Kit TgD814Y c-Kit - / - mladići su bili izrazito anemični, manji od svojih legla i svi su umrli prije rođenja (Dopunska slika 1E), što ukazuje da transgeni ne spašavaju spas smrtonosni fenotip c-Kit knockout miševa. Letalitet c-Kit TgD814Y c-Kit - / - uzrokovan je nedostatkom ekspresije transgena u jetri fetusa. Marginalni c-Kit izraz, nedovoljan za spašavanje fenotipa, primijećen je u c-Kit - / - i c-Kit TgD814Y c-Kit - / - jetri iz E15.5 vjerojatno zbog strategije korištene za c-Kit - / - generacija miša (Dodatne slike 1F i G i odjeljak metoda). Suprotno tome, imunofluorescentna analiza otkrila je ekspresiju transgena c-Kit u embrionalnom c-Kit TgD814Y c-Kit - / - srčanom tkivu, dok, kako se i očekivalo, nije primijećena ekspresija kod c-Kit - / - embriona (dodatna slika 1F). Ekspresija transgena c-Kit u srcu, osim glave, grana i luka, također je primijećena u ranijem razdoblju razvoja (dopunska slika 1G). Ova zapažanja proširuju znanje o ekspresiji c-Kit na rani razvoj srca 28, 29 i također ukazuju na važan pojam da se c-Kit TgD814Y transgeni eksprimiraju u srcu, ali ne u fetalnom i odraslom hemopoetskom tkivu. Stoga ovaj transgeni model miša nudi jedinstvenu prednost u odnosu na prethodne modele miša, jer isključuje da je bilo koji srčani fenotip sekundarni aktiviranom c-Kit receptoru unutar stanica koštane srži.

Aktivirani c-Kit receptor inducira ERK1 / 2 i AKT fosforilaciju

c-Kit receptor silazno signaliziranje uglavnom uključuje MAPK i PI3K staze. 10, 11, 30 Da bi se procijenilo jesu li ovi putovi aktivirani u c-Kit TgD814Y miševima, procijenjeni su E15.5 c-Kit TgD814Y c-Kit - / - i c-Kit - / - ekstraktima proteina cijele jetre i srca. ERK1 / 2 i AKT fosforilacija (slika 2a). Nisu primijećene različite razine fosforilacije ERK1 / 2 i AKT u jetrenim ekstraktima c-Kit TgD814Y c-Kit - / - u usporedbi s knockout miševima (slika 2a), kako se i očekivalo zbog izostanka transgene transgena u jetri (dopunska slika 1F ). Suprotno tome, u srčanim uzorcima c-Kit TgD814Y c-Kit - / - miševa primijećeno je malo, ali značajno povećanje fosforilacije AKT i snažno povećanje fosforilacije ERK1 / 2 u usporedbi s miševima c-Kit - / - (Slika 2a), Slična povećanja ERK1 / 2 i AKT fosforilacije primijećena su u ukupnim srčanim lizatima miševa s 3 dpp c-Kit TgD814Y c-Kit + / + u usporedbi s m -c-Kit + / + (Slika 2b). Povrh toga, veća fosforilacija ERK1 / 2 i AKT primijećena je i u transgeničnom c-Kit TgD814Y c-Kit + / + u usporedbi s c-Kit + / + svježe izoliranim preparatima srčane stanice za novorođenčad (Slika 2c). Zanimljivo je da aktiviranje c-Kit-a od strane njegovog endogenog liganda (KL) inducira ERK1 / 2 i AKT fosforilaciju u stanicama izoliranim iz wt srca do razine detektirane u stanicama transgena. Štoviše, KL nije uspio dodatno povećati razinu ERK1 / 2 i AKT fosforilacije u srčanim c-Kit + stanicama izoliranim iz transgenih životinja (Slika 2c). Ovi rezultati pokazuju da su MAPK i PI3K putevi aktivirani u srcima miševa c-Kit TgD814Y koji oponašaju endogenu stimulaciju liganda. Pred tretman Imatinibom uspio je spriječiti KL stimulaciju wt stanica, potvrdivši selektivnost aktivacije c-Kit / KL sustava (dopunska slika 2A). Kao što se očekivalo, Imatinib nije utjecao na c-Kit TgD814Y stanice, zbog konformacijskih promjena izazvanih mutacijom koje modificiraju katalitičku domenu (dopunska slika 2A).

Konačno, kao dokaz principa konstitutivne aktivacije c-Kit TgD814Y receptora, transgeni miševi koji izražavaju wt verziju c-Kit receptora (c-Kit TgWT ) iz originalnog BAC RP23-309C11 su prešli na C57 / BL6 miševe za procjena c-Kit ekspresije i aktivacija. Kao što je prikazano na Dodatnoj slici 2B, srca miševa c-Kit TgWT izrazila su dvostruko veću količinu receptora u usporedbi s kontrolnim lisicama, ali nije utvrđena razlika u autofosforilaciji ili aktiviranom signalnom putu ERK1 / 2 i AKT.

Ekspresija c-Kit receptora ne utječe na razvoj i morfologiju srca

Da bismo procijenili učinke aktivacije c-Kit receptora na srčano tkivo i strukturu, prvo smo utvrdili je li c-Kit konstitutivna aktivacija utjecala na broj ukupnih srčanih c-Kit + stanica u mutiranim miševima c-Kit TgD814Y . Kako bismo pojednostavili očitavanje kvantitativne imunohistokemije i FACS analize, križali smo c-Kit TgD814Y mutirane miševe s transgeničnim miševima koji eksprimiraju EGFP pod regulatornim redoslijedom c-Kit promotora ( pKit EGFP ). 31, 32

U c-Kit TgD814Y pKit EGFP dvostruka transgena srca, većina (preko 95%) stanica koje eksprimiraju c-Kit identificirane su bojenjem s anti-c-Kit antitijelom ekspresioniranim EGFP proteinom (slika 3a). Histološka analiza srčanog presjeka s miševa na 1 dpp, 10 dpp i 2 mjeseca pokazala je da se c-Kit + EGFP + stanice distribuiraju duž epikarda, šire u miokard i rjeđe su skupljene u endokardiju. Važno je da je broj EGFP + stanica bio usporediv u c-Kit TgD814Y pKit EGFP srcima i pKit EGFP u svim vremenskim točkama (Slika 3b). Nadalje, gustoća kapilara miokarda i veličine miocita bili su slični kod c-Kit TgD814Y pKit EGFP i pKit EGFP srca (podaci nisu prikazani). Dakle, ovi podaci pokazuju da konstitutivni aktivirani c-Kit receptor ne mijenja ukupni c-Kit + broj stanica, vaskularizaciju miokarda i rast miocita tijekom razvoja i homeostaze starije životne dobi, barem u dobi koju smo istraživali.

Image

c-Kit + na raspodjelu srčanih stanica ne utječe mutacija c-Kit TgD814Y in vivo . ( a ) Imunofluorescencija na srčanim sekcijama pripremljenim od 1 dpp, 10 dpp i odraslih c-Kit TgD814Y pKit EGFP miševa koji pokazuju intramiokardijalni (1 dpp i odrasli) i peri-vazalni (10 dpp) c-Kit + lokalizaciju stanica. Umetci pokazuju c-Kit (crveni) i EGFP (zeleni) koekspresiju. Ljestvice 30 μM ( b ) Broj EGFP + stanica u c-Kit TgD814Y pKit EGFP nasuprot pKit EGFP miševima pri 1 dpp, 10 dpp i Adult. Najmanje 20 odsjeka analizirano je za svako srce ( n = 3 miševa za svako dob i genotip). Secirano je cijelo srce i analizirano na 1 dpp miševa. Podaci su prijavljeni ± SE; * P <0, 05

Slika pune veličine

Izraz aktiviranog c-Kit receptora poboljšava popravljanje srca nakon ozljede

Da bi se izazvala uloga aktiviranih c-Kit stanica u popravku miokarda, krioinjurijom (CI) u srcima dvomjesečnih transgenih i težinskih miševa inducirano je oštećenje ventrikula (Slika 4). Opstanak životinja, sistemska upala i pregradnja srčanog tkiva ocijenjeni su kako bi se procijenio oporavak nakon srčane ozljede.

Image

Povećani preživljavanje i smanjena srčana fibroza u c-Kit TgD814Y mutantima nakon CI. ( a ) Kaplan-Meierova analiza preživljavanja kod c-Kit + / + ( n = 20) i c-Kit TgD814Y ( n = 12) miševa. Preživljavanje c-Kit TgD814Y miševa bilo je statistički značajno u usporedbi s c-Kit + / + 5 dana nakon ozljede (100% c-Kit TgD814Y u usporedbi s 57% tež.). Miševi koji su umrli tijekom operacije nisu uzeti u obzir za krivulju preživljavanja. ( b ) Vremenska crta koja prikazuje uzorkovanja krvi prije i nakon CI i prikupljanje srca. Regeneracija miokarda procijenjena je nakon 1, 4 i 6 tjedana nakon CI. ( c - e ) Citofluorimetrijske analize uzoraka krvi uzetih 1 tjedan prije CI i svaki tjedan dok nisu ubijeni miševi obojeni za površinske markere GR-1 i CD11b. Reprezentativno crtanje boje GR-1 i CD11b u krvi prikupljene s miševa c-Kit + / + i c-Kit TgD814Y 7 dana prije (gornja ploča) i 30 dana nakon (donja ploča) CI. ( c ) Krivulje koje predstavljaju srednje vrijednosti CD11b + GR-1 + ( d ) i CD11b + GR-1 - ( e ) krvnih stanica ( n = 8 miševa za svaku skupinu). Podaci su izvijestili ± SE Izvijestila se o značaju prvog uzorkovanja krvi bilo za c-Kit + / + i c-Kit TgD814Y , # P <0, 05. Značaj između c-Kit + / + i c-Kit TgD814Y uzoraka krvi izvještava se u različitim vremenskim točkama, * P <0, 05 ** P <0, 01. ( f ) Reprezentativni Masson trichromic obojeni sekcije miokarda od wt i transgeničnih miševa 1 mjesec nakon miokardne lezije. Plavo, fibrotično tkivo i crveni, miokarda održiv. Šipke za mjerenje 1mm. ( g ) Histogram koji pokazuje postotak fibrotičke površine u težinskim i transgeničnim miševima ( n = 7 i n = 9 za c-Kit + / + i c-Kit TgD814Y miševe, respektivno) mjesec dana nakon CI. Površine se mjere pomoću ImageJ softvera. Podaci su prijavljeni ± SE ** P <0, 01

Slika pune veličine

Kao što je prikazano na slici 4a, 43% c-Kit + / + miševa umrlo je u roku od 5 dana nakon ozljede, dok su c-Kit TgD814Y c-Kit + / + miševi bili otporni na uvredu jer nijedan mišev nije umro nakon operacije. Ovaj rezultat ukazuje da su transgeni miševi bili zaštićeni od akutnog oštećenja. Uzorci krvi prikupljeni su 1 tjedan prije ozljede srca i 1, 2 i 4 tjedna nakon oštećenja radi praćenja razine cirkulirajućih upalnih stanica. Relativne količine CD11b + Grl + i CD11b + Grl - mijeloidnih stanica analizirane su protočnom citometrijom (slike 4b-e). Ove dvije podskupine mijeloidnih stanica smatraju se pokazateljima upale tkiva i remodeliranja. 33, 34 Slike 4c-e pokazuju protuupalno CD11b + Grl + stanice koje se povećavaju i u wt i kod transgeničnih miševa 1 tjedan nakon oštećenja. Nakon 2 tjedna, postotak CD11b + Gr1 + stanica smanjio se na početnu vrijednost otkrivenu prije oštećenja na transgenim miševima, dok je njihov postotak ostao visok u težinskim miševima (Slike 4c i d). CD11b + Gr1 - postotak stanica pao je neposredno nakon CI u obje tretirane životinje, ali samo kod transgenih miševa vratio se na bazalnu razinu u roku od 2 tjedna (Slike 4c i e). Ovi podaci pokazuju da su CD11b + Gr1 + i CD11b + Grl - stanice različito modulirane u transgeničnim miševima u usporedbi s težinskim životinjama nakon ozljede srca. Ovi podaci također sugeriraju da je relativni postotak cirkulirajućih CD11b + Grl + i CD11b + Grl - u krvi paralelno s povećanim preživljavanjem transgenih miševa u usporedbi s mas.

Za izravnu procjenu štete utvrđene pomoću CI, mjeren je opseg fibrotičkog područja Masson Trikromno obojenje 3, 9 i 30 dana nakon oštećenja (Slike 4f ​​i g i Dodatne slike 3A i B). Dok 3 dana nakon oštećenja nije opaženo fibrotičko tkivo (podaci nisu prikazani), 9 dana nakon oštećenja pronađeno je veliko miokardijalno obojeno područje Masson-trihromije i u masnim i u transgeničnim miševima (dopunske slike 3A i B). U ovom trenutku, pronađena je slična razina apoptoze stanične stijenke ventrikularne stanice i u težinskim i u transgeničnim miševima (dopunska slika 3C). Međutim, 30 dana nakon oštećenja, fibrotičko područje bilo je trostruko manje kod transgenih miševa u usporedbi s težinskim životinjama (12, 83 ± 4% naspram 4, 39% ± 2, 44%) (Slike 4f ​​i g i Dopunska slika 3D). Istodobno, 30 dana nakon oštećenja, kardiomiociti u pograničnoj zoni transgenih miševa bili su manji u usporedbi s divljim miševima (dopunska slika 3E).

Ovi rezultati sugeriraju da miševi koji nose konstitutivno aktivirani c-Kit receptor imaju prednost kako u akutnom odgovoru na ozljedu miokarda, što je prikazano povećanom preživljavanju, tako i dugoročno, što pokazuje efikasnija sanacija nekrotičnog tkiva.

Aktivirana c-Kit receptorska ekspresija pospješuje regeneraciju endotela i kardiomiocita nakon ozljede in vivo

Da bismo razjasnili stanični mehanizam kojim ekspresija transgena potiče srčani popravak, istražili smo rast i diferencijaciju stanica koje eksprimiraju c-Kit TgD814Y nakon CI. Provedena je imunofluorescentna analiza radi identificiranja ukupnih srčanih c-Kit + stanica unutar ozlijeđenog područja 9 dana nakon ozljede (Slika 5a). U ovom trenutku, broj c-Kit + stanice koji je pokazao očigledan izduženi oblik, bio je veći kod transgenih miševa u usporedbi s wt miševima (Slika 5b; 72 ± 9 stanica / mm 2 i 55 ± 7 stanica / mm2). Da bismo potvrdili stopu posvećenosti vaskularnom rodu ukupnih c-Kit + stanica, procijenili smo ekspresiju c-Kit zajedno s endotelnim (CD31) i α- glatkim markerima aktinog glatkog mišića unutar oštećenog područja. c-Kit + stanice su praktički negativne na aktin glatkog mišića u oba genotipa, dok je više od 90% c-Kit + stanica obojenih s CD31 kod c-Kit TgD814Y miševa u usporedbi s ~ 60% u mt miševima (Slike 5c i d). Paralelno s tim, 30 dana nakon CI, primijećena je povećana gustoća kapilara kod transgeničnih miševa u usporedbi s težinskim miševima na peri-oštećenom području (Slika 5e). Konačno, transgeni i težinski miševi su implantirani mini-osmotskim pumpama za sistemsko oslobađanje BrdU-a odmah nakon ozljede tijekom 28 dana, kako bi se pratila regeneracija stanica miokarda. Trostruko povećanje novootvorenih, BrdU + kardiomiocita formiranih u nukleusu, zabilježeno je u transgeničnim srcima u usporedbi s wt miševima 1 mjesec nakon nekroze miokarda pomoću CI (Slika 5f). Svi ovi podaci sugeriraju da in vivo , konstitutivna aktivacija c-Kit receptora u stanicama miokarda potiče kardiovaskularni popravak povećavajući angiogeni i miogeni odgovor na ozljedu.

Image

c-Kit aktivacija inducira endotelnu i srčanu diferencijaciju u c-Kit TgD814Y srcima. ( a ) Imunofluorescencija c-Kit (crvena) 9 dana nakon ozljede u c-Kit TgD814Y i c-Kit + / + srčanom dijelu. Stup skale 30 µ m. ( b ) Histogram c-Kit + stanica ( n = 3 odsjeka analizirana su za 3 različita miševa). Podaci su izneseni ± SE ( c ) Imunofluorescencija za c-Kit (crvena), CD31, aktin glatkog mišića (zelena) u c-Kit TgD814Y i c-Kit + / + srčani dio 9 dana nakon CI. Zvezdica označava c-Kit pojedinačne pozitivne stanice. Šipke skale 30 µ m. ( d ) Histogram c-Kit + i CD31 + stanica unutar oštećenog područja ( n = 3 odjela analiziraju se za 3 različita miševa). Podaci su prijavljeni ± SE ** P <0, 01. ( e ) Reprezentativna slika c-Kit TgD814Y desne komore 30 dana nakon CI, obojena s IB-4 (zelena). Traka grafa histograma predstavlja promjenu nabora IB-4 + stanica pronađena u peri-oštećenom području ( n = 2 odsjeka analizirana su za 3 različita miševa). Linija mjerila 20 μ m. Podaci su prijavljeni ± SD * P <0, 05. ( f ) Reprezentativna slika c-Kit TgD814Y desne komore 30 dana nakon ugradnje srčane CI i BrdU. Umetanje pokazuje α- aktinin + / BrdU + / WGA + mono-nukleazirani kardiomiocit. Linija mjerila 50 μ m. Postotak BrdU koji uključuje kardiomiocite zabilježen je u histogramu (analizirano je n = 3 odsjeka za 5 različitih miševa). Podaci su prijavljeni ± SD * P <0, 05

Slika pune veličine

Aktivacija c-Kit receptora povećava CSC aktivaciju i diferencijaciju in vitro

Podaci prikazani gore ne mogu nedvosmisleno uspostaviti izravan odnos prekursora i diferenciranog staničnog proizvoda između počinjenih c-Kit + stanica i povećanog stvaranja endotelnih stanica i kardiomiocita u transgeničnim miševima nakon ozljede. Stoga smo izravno testirali ovu hipotezu izolirali CD45 - c-Kit + CSCs 35 od transgenih i wt miševa odraslih c-Kit TgD814Y (slika 6a). Kad su posađene u LIF-u uvjetovanom CSC medijumu, transgenične stanice c-Kit TgD814Y pokazale su povećan rast stanica u usporedbi s wt CSCs što je pokazalo njihova kinetička krivulja rasta i stopa inkorporacije BrdU in vitro (Slike 6b i c). Taj veći potencijal rasta bio je u korelaciji s povećanim klonogenskim potencijalom utvrđenim odlaganjem jednoćelija (Slika 6d). Nadalje, konstitutivna aktivacija c-Kit receptora potaknula je formiranje CSC sfere, in vitro marker multipotentnih stanica, u usporedbi s wt CSC-om (slika 6e). Te stanične karakteristike c-Kit TgD814Y CSC povezane su s aktivacijom c-Kit receptora, što je pokazano povećanom ERK1 / 2 i AKT fosforilacijom u transgeni u odnosu na wt CSC (Slika 6f). U stvari, AKT inhibicija MK2206, poznatog selektivnog alosternog inhibitora AKT, i ERK1 / 2 inhibicija PD98059, male molekule selektivno ciljane na ERK1 / 2, obje su mogle smanjiti stopu klogeneze i sferogeneze u transgeni c-Kit TgD814Y CSCs (slike 6 g i h).

Image

CSC-ovi se aktiviraju c-Kit TgD814Y . ( a ) protočna citometrija CSC-a izolirana iz c-Kit + / + i c-Kit TgD814Y srca. ( b i c ) Krivulja rasta stanica i procjena uključivanja BrdU c-Kit + / + i c-Kit TgD814Y CSC . Podaci su prijavljeni ± SD * P <0, 05. ( d i e ) Ispitivanje formiranja klona i sfere izvršeno je na c-Kit + / + i c-Kit TgD814Y CSC, a rezultati su zbrojeni u histogramskoj traci. Prikazane su reprezentativne slike klonova. Podaci su prijavljeni ± SD * P <0, 05. ( f ) WB i denzitometrijska analiza proteinskih ekstrakata iz c-Kit TgD814Y i c-Kit + / + CSC iz tri različita pokusa. ( g i h ) Ispitivanje formiranja klona i kuglice provedeno je na c-Kit TgD814Y CSC nakon 14 dana liječenja AKT (MK2206, 1 μM), ERK inhibitorom (PD98059, 100 µM) ili njihovom kombinacijom. Podaci su izneseni ± SD * P <0, 05 nasuprot neobrađenom uzorku (NT)

Slika pune veličine

Kad se stanice primete u kardiomiogeno stanje nisko seruma (2%) lišeno LIF-a, CSC-i miševa c-Kit TgD814Y pokazuju povećanu miogenu specifikaciju u usporedbi s wt CSC-ima. Zaista, povećani broj transkripcija mRNA za Nkx2.5, poznati faktor transkripcije kardiomiocita i za Myh7, Actc1 i Tnn3, glavni kontraktilni geni detektirani su u c-Kit TgD814Y u usporedbi s wt CSCs (slika 7a). I MK2206 i PD98059 tretman značajno su utjecali na vitalnost stanica u uvjetima miogenog diferencijacije s niskim serumom, sprječavajući specifičnost miogena s zanemarivom regulacijom gornje srčane transkripcije i mRNA kontraktilnih gena (podaci nisu prikazani).

Image

Pojačana endotelna diferencijacija c-Kit TgD814Y CSC - ova . ( a ) qRT-PCR na c-Kit TgD814Y i c-Kit + / + CSC za srčani marker nakon prebacivanja stanica u mediju za razlikovanje kardiomiocita. Podaci su izraženi kao kratni porast u odnosu na bazalni. Podaci su izneseni ± SD * P <0, 05 nasuprot bazalnim i # P <0, 05 u odnosu na c-Kit + / + . ( b ) Polukvatitativna RT-PCR kvantifikacija endotelnih markera 3 i 10 dana nakon prebacivanja c-Kit TgD814Y i c-Kit + / + CSC u endotelni medij. Rezultati su izraženi kao porast puta u odnosu na GAPDH ± SD * P <0, 05, ** P <0, 01 i *** P <0, 001. ( c ) Endotelna diferencijacija inhibirana je 72-satnim tretmanom inhibitorom ERK1 / 2 (U0, 10 µM ), ali ne i AKT inhibitorom (LY, 10 µM ). Podaci su prijavljeni kao promjena nabora mRNA ± SD naspram NT, * P <0, 05, ** P <0, 01

Slika pune veličine

S druge strane, kada su CSC-ovi postavljeni u specifični endotelni diferencijacijski medij-lišeni LIF-a, primijećeno je značajno povećanje transkripta endotelijalne RNA CD31 i VEGFR2 u c-Kit TgD814Y u usporedbi s c-Kit + / + CSC-ima već u 3 dana u diferencijaciji medijum, što je nakon 10 dana praćeno većim brojem CD31 + endotelnih diferenciranih stanica (slika 7b i dopunska slika 4A). Zanimljivo je da je endotelna diferencijacija ukinuta inkubacijom s inhibitorom MAPK (UO), ali ne i s AKT inhibitorom (LY) (slika 7c i dopunska slika 4B), što sugerira da je MAPK potreban za diferencijaciju endotela loge podsticanih c-Kit.

Sveukupno, ovi podaci pokazuju da, in vitro , konstitutivna aktivacija c-Kit receptora djeluje nekoliko blagotvornih učinaka na CSC, pojačavajući njihovo pojačavanje, kad se primiriraju na razmnožavanje, i promiču njihovu diferencijaciju kardiomiocita i endotela, kada se dodaju na određenu predanost srčane stanice.

Rasprava

U ovom istraživanju stvoren je novi model miša koji eksprimira c-Kit receptor aktivirajućom aminokiselinskom supstitucijom za proučavanje ekspresije i aktivacije receptora u srčanom razvoju i njegove uloge tijekom regenerativnih procesa. Transgeni miševi generirani su mutirajući BAC vektor koji sadrži endogene regulatorne sekvence od 67 Kb uzvodno od početnog koda i 58 Kb nizvodno od zaustavnog kodona. Kao što je prethodno opisano za druge transgene miševe generirane s vektorima koji obuhvaćaju slična područja c-Kit lokusa, ekspresija transgena 27, 36 nije otkrivena u jetri fetusa i koštanoj srži odrasle osobe, vjerojatno zbog nedostatka regija za pojačavanje u regulatornom slijedu BAC, 27 ali je njegova ekspresija i aktivacija porasla dvostruko u usporedbi s težinom u srcu, osim u moždanom i testisu. Na taj je način bilo moguće prvi put proučavati aktivnost receptora fiziološki izraženu u srčanom tkivu i razjasniti kontroverzne nalaze izviještene o pretpostavljenom doprinosu koštane srži u odnosu na stanične c-Kit + stanice u popravljanju srca. 18, 22, 23, 37

C-Kit + divlji tip stanice reagira na c-Kit kognitivni ligand povećavajući ERK1 / 2 i AKT fosforilaciju. 38, 39 Zanimljivo smo pronašli kontinuirano povećanje razine ERK1 / 2 i AKT fosforilacije u srcima i izoliranim pripravcima srčanih stanica dobivenim u različitim dobima transgenih miševa. Ova razina aktivacije, specifična za mutaciju aktivirajućeg gena i potvrđena analizom proteina c-Kit TgWT miševa, nije dalje stimulirana liječenjem stanica specifičnim c-Kit ligandom.

Sve u svemu, ovi rezultati podržavaju i snažno potvrđuju da su ERK1 / 2 i AKT među glavnim metama c-Kit receptora u srčanim c-Kit + stanicama. Zapravo, supstitucija aspartanske kiseline 814 tirozinom uspjela je rekapitulirati aktivaciju PI3K i MAPK puteva koji se prirodno događaju nakon KL stimulacije wt receptora, omogućujući tako da se istraži fiziološka uloga c-Kit receptora u srcu. 814 Aspartic mutacija prethodno je pronađena u različitim vrstama tumora, a prijavljeno je da inducira konstitutivnu aktivaciju c-Kit. 24, 25, 26 Posebno su transgeni miševi koji nose mutaciju c-Kit TgD814Y praćeni više od 2 godine i nisu otkriveni tumori poput GIST-a, semioma ili mastocitoze.

Potpuno karakteriziranje ekspresije c-Kit TgD814Y u srcu izvršeno je WB-om i imunohistokemijom pokazujući da se aktivirani receptor eksprimira tijekom embriogeneze, neonatalnog i odraslog života. BAC vektori, čuvajući endogenu regulaciju gena, dali su priliku za proučavanje srčanih c-Kit + stanica u odnosu na njihovo pretpostavljeno podrijetlo od prvog srčanog polja, proepicardija ili epitela do mezenhimalnog prijelaza. Daljnja karakterizacija potrebna je za provjeru jesu li dvije subpopulacije koje izražavaju nisku i visoku razinu c-Kit, nedavno opisane, 40, 41, 42, 43, različito regulirane u srcima c-Kit TgD814Y miševa. Križanjem c-Kit TgD814Y miševa na pKit EGFP miševe zaključili smo da su broj i lokalizacija c-Kit + EGFP + dvostruko pozitivnih stanica slični između pKit EGFP i c-Kit TgD814Y pKit EGFP srca što ukazuje na slično ponašanje wt i transgenih stanice u netaknutom organu. Ova opažanja sugeriraju da konstitutivna aktivacija ERK1 / 2 i AKT staze in vivo ne utječe na proliferaciju i / ili staničnu smrt ovih stanica u normalnim uvjetima ili da se ovi događaji događaju u uskom prozoru prije nego što c-Kit + stanice podvrgnu diferencijaciji. S druge strane, pokusi in vitro pokazali su bolju proliferaciju i potencijal rasta c-Kit TgD814Y CSC-a pročišćenih od odraslih miševa c-Kit TgD814Y što ukazuje da je mutacija receptora sama po sebi sposobna u potpunosti aktivirati program proliferacije ovih stanica.

Da bismo testirali učinkovitost transgena u regeneraciji srca, iskoristili smo CI tehniku. 44, 45 CI izabran je jer može izazvati žarišno, transmuralno i reproduktivno oštećenje srca. Transgeni miševi bili su otporniji na ozljede (slika 4). Svi su miševi preživjeli nakon CI i pokazali su obnavljanje srčanog tkiva u roku od mjesec dana nakon oštećenja, sugerirajući zaštitnu ulogu cge Kit TgD814Y transgena.

Nadalje, uočeno je konzistentno smanjenje fibrotičke površine nakon CI kod transgenih miševa (slika 4f). Devet dana nakon CI povećao se broj c-Kit + stanica na oštećenom području c-Kit TgD814Y miševa u usporedbi s c-Kit + / + miševima (Slika 5b). Budući da je objavljeno da ERK1 / 2 i AKT fosforilacija mogu izazvati migraciju i / ili diferencijaciju matičnih stanica, 17, 39, 46, naša otkrića pokazuju da bi se ovi mehanizmi mogli pojaviti i nakon CI kod c-Kit TgD814Y miševa. Ova hipoteza je u skladu s promatranjem brojnih izduženih c-Kit + stanica na oštećenom području koje izražavaju endotelni marker CD31 i s većom gustoćom kapilara koje se nalaze u peri-oštećenom području transgenih srca, što omogućuje nagađanje da c-Kit aktivacija potreban je za stvaranje novih žila tijekom rane faze popravljanja srca. Ovi su rezultati u skladu s nedavnim nalazima koji pokazuju da su c-Kit + stanice zauzete za endotelnu diferencijaciju 42, 47, 48 i po prvi put pokazale da je aktiviranje MAPK, ali ne i AKT signalnog puta, temeljno za c-Kit- posredovana endotelna diferencijacija. Štoviše, rezultati dobiveni BrdU inkorporiranjem također sugeriraju ulogu c-Kit TgD814Y receptora u regeneraciji miocita nakon ozljede srca koja pogoduje prometu kardiomiocita za obnavljanje srca. In vivo bipotencijalna sudbina c-Kit TgD814Y prekursora koji podržavaju diferencijaciju endotela i kardiomiocita potvrđena je in vitro pročišćavanjem i selektivnim kultiviranjem CSC -ova c-Kit TgD814Y i pokazujući da su za rast CSC i klonogena svojstva potrebni i MAPK i AKT stazi. kao i za njihovo endotelno i miogeno zalaganje. Sveukupno, ovi rezultati ističu presudnu ulogu aktivacije c-Kit receptora u popravljanju srca s izrazitim uključivanjem AKT i / ili ERK1 / 2 signalnih putova za posredovanje c-Kit funkcija kako kod zdravih, tako i kod ozlijeđenih srca.

Materijali i metode

Generacija miševa

Generiranje c-Kit TgD814Y transgeničnih miševa dobiveno je zamjenom G u T 2468 u c-Kit genu mišjeg BAC RP23-309C11 homolognom rekombinacijom kao što je prethodno opisano. 49, 50

The murine BAC RP23-309C11, containing 80 kb of c-Kit genome sequence and 68 kb of sequence upstream and 57 kb of sequence downstream the c-Kit initiation and stop codons, respectively, was engineered substituting the G to T 2468 to generate c-Kit TgD814Y transgenic mice. Electrocompetent DH10B bacteria with the BAC RP23-309C11 were electroporated with 100 bp oligos containing complementary 20 bp mutated regions around the G to T 2468 nucleotide responsible for the switch of aspartic to tyrosine amino acid. Following the first homologous recombination driven by a temperature-inducible mini- λ phage, a second electroporation, was performed using a 100 bp oligos pairs with the G to T 2468 substitution surrounded with endogenous c-Kit sequence to replace the first oligos pairs and leave the single point mutation. Following the second homologous recombination, the mutation was inserted in the BAC RP23-309C11. The G to T 2468 mutation was confirmed by sequencing analysis and the purified BAC was microinjected into the pronuclei of fertilized C57BL/6 eggs by standard methods. Founder lines were identified by RT-PCR analysis using Sp6 For (5′-ATTTAGGTGACACTATAG-3′) and 309 Rev (5′-CTCTTCTTGACAGTTCCTGC-3′) and CM for (5′-TGTTCACCCTTGTTACACCG-3′) and CM Rev (5′-CCACTCATCGCAGTACTGTT-3′) primers designed in between the vector and c-Kit gene and in the chloramphenicol resistance cassette, respectively.

Two transgenic founders lines, Tg7 and Tg8, were maintained by breeding them to C57BL/6 mice. Homozygotes pKit EGFP (gifted by Prof Ottolenghi, 31 ) were crossed with c-Kit TgD814Y c-Kit +/+ to generate c-Kit TgD814Y c-Kit +/+ pKit EGFP mice (referred as c-Kit TgD814Y pKit EGFP ).

Heterozygote c-Kit + /− mice were generated by replacement of the 16 th intron with a PGK-Neo cassette through homologous recombination, resulting in functional inactivation of the gene. A 7 kb BamH1 fragment of the mouse c-Kit gene spanning from intron 14 to intron 17 was utilized to generate by PCR amplification a 1.5 Kb left arm of homology (spanning from intron 14 to exon 16, with an artificial 3′ Xho I site) and a 4.5 Kb right arm of homology (spanning from exon 17 to intron 17, with an artificial 5′ EcoRV site). A Xho I-EcoRV 1.6 Kb PGK-Neo cassette was added upstream to the EcoRV site of the right arm, and a Sal I 3.0 Kb PGK-TK cassette was added to the 3′ Bam H1 site (after partial filling of the Sal I site in the cassette and the Bam H1 site in the right arm). Subsequently, the left arm of homology was added to the Xho I site of the construct. A 11 Kb Not I gene targeting fragment (containing sequentially the left arm of homology, the PGK-Neo cassette, the right arm of homology and the PGK-TK cassette, see Supplementary Figure 1) was electroporated in ES cells, which were subsequently treated with neomycin and gancyclovir for positive and negative selection, respectively. Screening of homologous recombinant ES colonies was performed by Southern blot using a 600 bp EcoRV- Bam H1 external 5′ genomic c-Kit probe and digesting genomic DNA with EcoRV. Positive recombinants were identified by the appearance of a 3 Kb diagnostic band. The identified recombinant ES colonies were injected in mouse blastocysts by standard methods to generate heterozygous mice in which the 1 kb 16th c-Kit intron had been replaced by the 1.6 Kb PGK-Neo cassette. Heterozygote c-Kit +/− mice were crossed with c-Kit TgD814Y c-Kit +/− to generate c-Kit TgD814Y c-Kit +/+ , c-Kit TgD814Y c-Kit +/− or c-Kit TgD814Y c-Kit −/− mice. These mice showed all the typical phenotypic aspects of the White spotting mutation, including lethality in the homozygous condition, are in agreement with previous evidence that the inclusion of a neo gene in intronic sequences severely interferes with the expression of the c-Kit gene. 51

Mice of 1–9 dpp and adults were killed by cervical dislocation. All our investigations conform with the Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes, and were conducted with the approval of the Tor Vergata University's Animal Use for Research Ethic Committee and by the Italian Ministry of Health.

Copy number assay

In order to quantify c-Kit TgD814Y transgene copy number, we performed a real-time PCR assay, based on evaluation of genomic c-Kit sequence from the transgene. Probe and primers were specific for exon 14 of the c-Kit gene.

The c-Kit TgD814Y copy number was determined using TaqMan Copy Number Assays (Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. In brief, genomic DNA (20 ng) was combined with 2 × TaqMan Genotyping Master Mix, TaqMan Copy Number Assay for mouse c-Kit (Mm00161478_cn Cat. # 4400291) and TaqMan Copy Number Reference Assay for mouse Tert in a 20 μ l reaction volume. The assay was performed using the Applied Biosystems I 7500 Fast Real-Time PCR System (Life Technologies, Thermo Fisher Scientific) and the following thermal cycling conditions: 95 °C for 10 min, and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Samples were assayed using triplicate wells for each gene of interest and copy numbers were estimated by relative quantitation normalized to the known copy number of the reference sequence using the comparative Ct (ΔΔCt) method. The Ct data were subsequently compared with a calibrator sample known to have two copies of the target sequence, analyzed by Applied Biosystems CopyCaller Software (v.2.0; Applied Biosystems) according to the product instruction. Each analysis was carried out with three mice tail DNA of c-Kit +/+ and c-Kit TgD814Y c-Kit +/+ mice. The analysis indicates that transgenic mice integrated one copy of BAC RP23-309C11 construct in genomic DNA. *** P 80% and ΔCq standard deviation between replicates was <0.20.

Newborn cardiac cells isolation, stimulation and immunofluorescence

Cardiac cells were prepared from ventricles of 1–3 dpp newborn pups and cultured as previously described. 52

Freshly isolated newborn cardiac cells, pretreated or not for 30 min with 5 μ M Imatinib-mesylate (sc-202180, Santa Cruz Biotechnology, Inc., Dallas, TX, USA), were stimulated for 10 min with 100 ng/ml KL (R&D Systems, Inc., Minneapolis, MN, USA) before protein extraction.

Immunofluorescence on newborn neonatal myocytes was performed after 24 h of culture. Cells were fixed with 4% PFA, blocked with PBS/0.5% BSA/3% horse serum and stained overnight at 4 °C with mouse anti-sarcomeric myosin (1:5; MF20, Hybridoma Bank, Iowa, IA, USA); rabbit anti-MEF2C (1:100; Abcam: ab64644, Cambridge, UK) and goat anti-c-Kit (1:100; R&D) and then incubated 1 h at 37 °C with anti-rabbit FITC and anti-goat Cy5 secondary antibodies (1:300; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA). Images were acquired by Nikon Eclipse Ti - S microscope (Nikon Instruments SpA, Firenze, Italy).

Adult CSC purification and differentiation

CSCs were isolated from adult transgenic and wt hearts by enzymatic methods. 35, 40 For CD45 c-Kit + cell purification, myocyte-depleted small cardiac cells were incubated with microbeads conjugated with anti-mouse CD45 antibody (Miltenyi Biotec Srl, Calderara di Reno (BO), Italy) and removed from the preparation by magnetic-activated cell sorting (Miltenyi). From the CD45 fraction, the c-Kit + (CD45 ) cardiac cells were enriched through incubation with a microbeads-conjugated mouse monoclonal antibody against c-Kit (Miltenyi) and separated by magnetic-activated cell sorting.

Freshly isolated CD45 c-Kit + cardiac cells were cultured on gelatin-coated dishes in CSC growth medium 35, 40 before clonogenic, spherogenic and BrdU assays.

Cardiosphere myogenic differentiation was performed as previously described. 35

Endothelial differentiation was obtained by culturing the CSC for 3–10 days in MEM Alpha (Life Technologies), 10% ESQ-FBS (Life Technologies), 1 μ M dexamethasone, 50 μ M/ml ascorbic acid, 10 mM β -glycerophosphate (all from Sigma-Aldrich, Milano, Italy) and 10 ng/ml VEGF (PeproTech EC Ltd., London, UK). LY294002 (10 μ M, Calbiochem, San Diego, CA, USA) and UO126 (10 μ M, Cell Signalling Technology, Danvers, MA, USA) were added to the culture for AKT and ERK1/2 inhibition.

Clonogenic, spherogenic and BrdU assays

To show clonogenicity, single-cell cloning was used through depositing single CD45 c-Kit + cardiac cell into wells of 96-well gelatin-coated Terasaki plates by serial dilution. Individual CD45 c-Kit + cells were grown in mCSFM for 1–3 weeks when clones were identified. 35, 40 The clonogenicity of the CD45 c-Kit + cells was determined by counting the number of wells in each 96-well plate, which contained clones and expressed as a percentage. A total of 10 plates were analyzed for each experiment.

For cardiosphere generation, CD45 c-Kit + CSCs were placed in bacteriological dishes with cardiosphere generation medium (mCSFM) composed of 1:1 ratio of CSC growth medium and Neural Basal Media supplemented with B27 and N2 supplements (Life Tech). Cardiospheres were counted per plate at 14 days and the number expressed as a percentage relative to the number of plated CSCs. 35, 40 For Akt inhibition, MK2206 (Enzo Biochem, New York, NY, USA) was used at a concentration of 1 μ M. For Erk1/2 inhibition, PD98059 (Cell Signaling) was used at a concentration of 100 μ M.

To assess the proliferative activity of c-Kit + CD45 cardiac cells in vitro , 10 μ M bromodeoxyuridine (BrdU, Roche, Monza, Italy) was administered in cell plate for 30 min after 48 h serum-free medium conditions (T0) and every 8 h for 1 day. Then, cells were analyzed by flow cytometry (PE-conjugated Anti-BrdU, eBiosciences, San Diego, CA, USA).

Bone marrow and blood cells isolation

Bone marrow cells were isolated from adult mice by flushing both femurs and tibias with 2 ml of PBS using a 25-gauge needle syringe. Cells were pelleted, washed and re-suspended for the analysis.

For white blood inflammatory and remodeling marker staining, 200 μ l of blood samples were collected from mice eyes in heparin-treated vials then red blood cells were lysated using RBC Lysis Buffer (BioLegend, London, UK) as the protocol.

Analiza protočne citometrije

Bone marrow cells were re-suspended in FACS buffer (PBS/2% FBS/2 mM EDTA) and stained for 1 h at 4 °C with rat anti-c-Kit CD117 Alexa Fluor 647 (Invitrogen: RM6221, Thermo Fisher Scientific-Life technologies, Waltham, MA, USA) antibody. Dead cells were stained with 7 Amino-Actinomycin D dye (Sigma Aldrich).

White blood cells were stained in 100 μ l of FACS buffer with rat anti-CD11b PE-Cy7 (Pharmingen: 25-0112, Gurgaon, Haryana, India) and rat anti-GR-1 APC antibodies (Pharmingen: 17-5931) at 4 °C for 1 h. Dead cells were stained with Sytox-Blue dye. Analysis was performed with CyAn cytofluorimeter (Dako, Milano, Italy).

Isolated CSC analysis was performed on FACSCanto II with FlowJo software to identify c-Kit expression by mouse monoclonal APC-conjugated anti-c-Kit antibody (Miltenyi). Appropriate labeled isotype controls were used to define the specific gates.

mRNA extraction and RT-PCR analyses

mRNA was extracted from CSCs with Trizol (Sigma Aldrich) using Qiagen RNAEasy miniKit (Milano, Italy) following the manufacturer's instructions. Traces of genomic DNA were removed before retro-transcription using DNA Free Zymo Research kit. RNA was quantitated using a Nanodrop 2000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and 0.5–1.0 μ g of total RNA was retro-transcribed using SuperScript II transcriptase (Life Technologies/Invitrogen/Thermo Fisher Scientific) according to the manufacturer's instructions using the High Capacity cDNA Kit (Applied Biosystems).

Reverse transcription-qPCR was performed with the TaqMan Primer/Probe sets (specific primers were purchased from Invitrogen and the relative catalog numbers are available upon request) using StepOne Plus Real Time PCR System (Applied Biosystems) following the manufacturer's instruction.

Data were processed by the ΔCt method using StepOne Software v2.3. mRNA was normalized with GAPDH and all reactions were carried out in triplicate.

For semiquantitative RT-PCR, primers were as follows: CD31 forward 5′- CGAAGTTAGAGTTCTCCTCC-3′ and CD31 reverse 5′- TCTGATACTGCGACAAGACC-3′; VEGFR1 forward, 5′-GGTATGACTTCTGCACTGAG-3′ and VEGFR1 reverse 5′- CACCAATGTGCTAACCGTCT-3′; VEGFR2 forward, 5′-GTGTCTCTTTGCGCTAGGTA-3′ and VEGFR2 reverse, 5′-TTGCCTCACAGAAGACCATG-3′;

Isl1 forward, 5′-GCAGCAACCCAACGACAAAA-3′ and Isl1 reverse, 5′-AATTGACCAGTTGCTGAAAAGC-3′; GAPDH forward 5′-GTGAAGGTCGGTGTGAACG-3′; GAPDH reverse 5′- ATTTGATGTTAGTGGGGTCTCG - 3′. RT-PCR products were separated in a 1% agarose gel stained with ethidium bromide.

Immunoprecipitation and WB analyses

Heart tissue, newborn cardiac cells and CSCs were homogenized into RIPA buffer (150 mmol/l NaCl, 50 mmol/l Tris-HCl pH 7.6, 1% NP40, 0.5% Sodium deoxycholate, 0.1% Sodium dodecyl sulfate, 10 mmol/l β -glicerophosphate, 1mmol/l DTT) containing phosphatase and protease inhibitors before WB analysis as described in Supplementary Methods.

For immunoprecipitation analyses, specific antibodies were incubated with a mixture of protein A and/or G-Sepharose beads (Sigma-Aldrich) in lysis buffer containing 0.05% BSA for 60 min under constant shaking at 4 °C. The beads were then washed twice with lysis buffer and incubated for 90 min at 4 °C with clarified cell lysates under constant shaking. Sepharose beads-bound immunocomplexes were rinsed three times with lysis buffer and eluted with Laemmli buffer. Proteins were separated on SDS-PAGE 8% gels and transferred to PVDF membranes (GE Healthcare, Milano, Italy). These were incubated overnight at 4 °C with rabbit anti-c-Kit (1:100) sc-168; mouse anti-pERK1/2 (1:1000) sc-7383; rabbit anti-ERK 2 (1:1000) sc-154; rabbit anti-pAKT1/2/3-ser473 (1:1000) sc-7985; mouse anti-AKT1/2/3 (1:1000) sc-81434; mouse anti-pTyr (1:1000) Millipore 05-321 (Vimodrone (MI), Italy); mouse anti-tubulin (1:2000) Sigma T 5168 all from Santa Cruz Biotechnology and then with the appropriate horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology). The horseradish peroxidase conjugate was detected by chemiluminescence with an ECL Kit (Santa Cruz Biotechnology) and autoradiography. Densitometry was performed using Molecular Dynamics Densitometer and ImageJ software.

Protein lysates obtained from CSCs (~50 μ g) were separated on 10% SDS-polyacrylamide gels. After electrophoresis, proteins were transferred onto nitrocellulose filters, blocked with either 5% dry milk or 5% bovine serum albumin, and incubated with Abs against AKT (#9272), p-AKT (#4058 S), ERK1/2 (#9102) and pERK1/2 (#9101) (all from Cell Signaling) at dilutions suggested by the manufacturers. Proteins were detected by chemiluminescence using horseradish peroxidase-conjugated 2Abs and the Alliance UVITEC Cambridge system (Eppendorf, Milano, Italy).

Heart injury

The CI was performed by a technician blinded to the genotype of mice, essentially as previously reported. 45 Briefly, under general anesthesia with Avertin (Sigma, 250 mg/kg), mice were subjected to surgery. The abdominal cavity was opened and CI was inflicted through the intact diaphragm on the heart pushed toward the probe. Heart damage was performed by applying for 5 sa 5 mm diameter metal probe cooled to −196 °C with liquid nitrogen. The abdominal cavity was closed with sutures. Mice received 500 μ l of glucose solution (5% glucose in physiologic solution) and the analgesic Atradol (3 mg/kg), soon after the surgery. Mice were killed and their hearts harvested 3 ( c-Kit +/+ n =2; c-Kit TgD814Y c-Kit +/+ n =2), 9 ( c-Kit +/+ n =10; c-Kit TgD814Y c-Kit +/+ n =8) and 30 ( c-Kit +/+ n =12 and c-Kit TgD814Y c-Kit +/+ n =13) days after the CI.

A set of mice ( c-Kit +/+ n =10; c-Kit TgD814Y c-Kit +/+ n =10) were treated with BrdU for 30 days. Half of them, for each genotype, was damaged with CI as previously described. BrdU (0.6 M) was administered continuously using Alzet osmotic mini pumps (Charles River Laboratories, CALCO (Lecco), Italy). The latter were implanted subcutaneously in the dorsal region via a small interscapular incision using sterile surgical technique, while the animals were under light avertin anesthesia.

Tissue harvesting, immunofluorescence, immunohistochemistry and TUNEL assay

Hearts were collected at different ages, the atria were removed and the ventricles were placed in Hank's balanced solution (Euroclone, Pero (MI), Italy) squeezing gently to remove the remaining blood from the chambers. After washing in PBS, the ventricles were embedded in OCT (Bio-Optica, Milano, Italy), frozen in isopentane chilled with liquid nitrogen and stored at −80 °C before immunohistochemistry and immunofluorescence analyses as described in Supplementary Methods. In order to preserve GFP, ventricles taken from pKit EGFP mice and c-Kit TgD814Y pKit EGFP mice were pre-fixed in PBS/4% PFA pH 7.4 (Sigma) overnight at 4 °C and then included in OCT. Embryos were directly included in OCT, frozen in isopentane chilled with liquid nitrogen and stored at −80 °C.

For EGFP + cardiac cell count, at least 20 sections of 5 μ m thickness were collected from each heart and analyzed for c-Kit and EGFP staining at different postpartum developmental time for pKit EGFP mice and c-Kit TgD814Y pKit EGFP mice: at 1 day n =4 and n =5 mice, respectively; at 10 days n =4 and n =6 mice, respectively; at 2 months old n = 5 and n =6 mice, respectively. Images were acquired with Zeiss microscope (Axioskop 2 plus, Zeiss, Carl Zeiss Microscopy, Thornwood, NY, USA). EGFP-positive cardiac cells were counted throughout the left and right ventricle for each section. The EGFP-positive cell number was calculated as mean number per section.

Immunofluorescence was performed in 5 μ m-thick sections fixed in PBS/4% PFA for 10 min at room temperature before staining. After permeabilization and blocking with PBS/1% BSA, slices were incubated with primary antibodies diluted in PBS/1% BSA overnight at 4 °C. Undamaged and damaged heart sections were stained with the following primary antibodies: goat anti-c-Kit (R&D) 1:100 and rat anti-CD31 (eBioscience: 14-0311) 1:100; rabbit anti- α -SMA (Abcam: ab5694) 1:100. In order to reveal c-Kit receptor in embryos, sections were stained with goat anti-c-Kit (R&D) diluted 1:50. Secondary antibodies anti-rat Alexa Fluor 488, anti-rabbit FITC and anti-goat Cy5 all from Jackson were diluted 1:300. Nuclei were stained by Hoechst 33342 solution.

To quantify fibrotic tissue, trasversal serial sections of ventricles (5 μ m of thickness) were collected, fixed in Bouin solution (Sigma) and stained with Masson's Trichrome kit (Sigma). Collagen was detected in blue and myocardial cells in red. Images were acquired by Axioskop 2 plus, Zeiss microscope and ImageJ software was used to quantify the fibrotic area. The fibrotic residual area of each collected section was measured in pixels and expressed as percentage respect to total area, without the lumen. The injured size was then calculated as the mean percentage of slices for all ventricles.

Apoptosis was evaluated on three heart sections derived from three different c-Kit +/+ and c-Kit TgD814Y c-Kit +/+ mice 9 days after the CI by following TUNEL assay (Roche) manufacturer's instructions.

BrdU, WGA and IB-4 stainings

Damaged hearts from BrdU-treated mice were perfused with buffered formalin and embedded in paraffin, and 5 μ m-thick sections were cut.

Antigen retrieval was achieved using Target Retrieval Solution, Citrate pH 6 (DAKO). Myocyte cytoplasm was detected using an antibody against α -actinin (1:50 dilution, Clone H-300, Santa Cruz Biotechnology) for 3 h at 37 °C and this was detected with anti-rabbit Alexa Fluor 647 (1:100 dilution; Jackson Immunoresearch Laboratories, Inc., West Grove, PA, USA). BrdU was detected using an antibody against BrdU (1:50 dilution; Roche) for 45 min at 37 °C. This antibody was detected with an anti-mouse Alexa Fluor 488 (1:100 dilution; Jackson Immunoresearch). Newly formed myocytes were detected through double staining for BrdU and α -actinin. Secondary antibody incubation was carried out at 37 °C for 1 h. Wheat germ agglutinin (Alexa Fluor 594 conjugate WGA; Life Technologies) staining was performed for cardiomyocyte dimension analysis. The nuclei were counterstained with the DNA-binding dye, 4, 6-diamidino-2-phenylindole (Sigma) at 1 μ g/ml. Sections were mounted in Vectashield and analyzed and scanned using confocal microscopy (Leica Microsystems TCS SP5, Milano, Italy). ImageJ software was used to quantify the cardiomyocyte area.

For IB-4 staining, 5 μ m heart sections were deparaffinized and treated with 10 mM sodium citrate solution (Santa Cruz Biotechnology), pH 6.0, in microwave for 10 min. After permeabilization with 0.1% PBS-Triton X-100 v/v at RT for 8 min, sections were blocked with PBS-1% BSA w/v for 30 min at RT and capillaries were stained with IB-4 - FITC conjugated (Sigma) overnight at 4 °C. Nuclei were stained with Hoechst 33342. Slides were mounted with glycerol in 50 mM Tris-HCl solution pH 8.7 (1:1). Images were acquired by Nikon Eclipse Ti - S microscope. The number of capillary was counted in 10 images/section and reported as fold change.

Statističke analize

Statistical analysis was performed with GraphPad Prism version 6.00 for Macintosh (GraphPad Software, Inc., La Jolla, CA, USA). Quantitative data are reported as mean±SE or mean±SD and binary data by counts. Significance between two groups was determined by Student's t test or paired t test as appropriate. For comparison between multiple groups, ANOVA was used. Vrijednost P <0, 05 smatrala se značajnom. Bonferroni post hoc method was used to locate the differences. In these cases, the type 1 error ( α =0.05) was corrected by the number of statistical comparisons performed. If not specified, a n =4 sample size was used for the in vitro cell and molecular biology experiments. The Kruskal–Wallis (for multiple‐group comparison) and the Mann–Whitney U tests (for comparison between two groups) were performed.

Dodatna informacija

PDF datoteke

  1. 1.

    Dodatna informacija

Glosar

CI

cryoinjury

eksplozivnim dizanjem utega

cardiac stem cells

IB-4

isolectin B4

KL

c-Kit ligand

Dodatne informacije nalaze se u ovom radu na web stranici Cell Death and Disease (//www.nature.com/cddis)