Androgeni moduliraju autofagiju i staničnu smrt regulacijom proteina 78 / bip reguliranim glukozom endoplazmatski retikulum glukozom u stanicama karcinoma prostate | stanična smrt i bolest

Androgeni moduliraju autofagiju i staničnu smrt regulacijom proteina 78 / bip reguliranim glukozom endoplazmatski retikulum glukozom u stanicama karcinoma prostate | stanična smrt i bolest

Anonim

teme

  • autophagy
  • Regulacija gena
  • Hormonske terapije
  • Rak prostate

Sažetak

Signalizacija proživljavanja posredovana receptorom androgena (AR) podrazumijeva kao ključni doprinos kancerogenezi prostate. Kako su tumori prostate karakteristični za mikrookolje siromašno hranjivim tvarima, hipoksično i zakiseljeno mikrookruženje, jedan mehanizam kojim AR signalizacija može pridonijeti preživljavanju je promicanje prilagodbe staničnom stresu. Ovdje smo identificirali novu ulogu AR-a u inhibiciji autofagije izazvane povlačenjem seruma. Ova blokada pripisuje se AR-posredovanoj regulaciji endoplazmatskog retikuluma (ER) kapeperona glukoze reguliranog glukozom i događa se neovisno o aktiviranju puta na stres odziva ER. Zanimljivo je da AR aktivacija nije utjecala na serumsku inhibiciju rapamicina uzrokovanu serumskom gladovanjem, ilustrirajući da adaptivna uloga androgena ne leži u sposobnosti moduliranja osjetljivosti hranjivih tvari, već u promicanju stabilnosti ER. Konačno, pokazujemo da je adaptivna prednost koju daje AR-posredovana Grp78 / BiP regulacija privremena, jer nakon kronične gladovanja serumu AR aktivacija kasni, ali nije suzbila početak autofagije i stanične smrti. Ova studija otkriva novi mehanizam prema kojem održavana AR signalizacija potiče privremenu prilagodbu staničnog stresa i zauzvrat može doprinijeti izbjegavanju smrti tumorskih stanica prostate.

Glavni

Rak prostate je hormonalna bolest, za njezin razvoj ovisi endogeni androgeni. Ablacija androgena najčešći je oblik terapijske intervencije za oboljele od raka prostate, što rezultira raširenom smrću epitela prostate. 1 Mnoga su istraživanja pokušala razgraničiti presjek između androgenih receptora (AR) i antiapoptotskih signalnih putova; 2, 3, 4, 5, 6, međutim, doprinos AR makroautofagiji (u daljnjem tekstu autofagija), mehanizmu koji može promicati opstanak stanica ili doprinijeti staničnoj smrti, tek je nedavno cijenjen. 7, 8, 9, 10 Autofagija je homeostatski proces pri kojem stanica zahvaća oštećene i dugovječne proteine, organele i citoplazmatske komponente u autofagosome. Autofhagosomska fuzija s lizosomima omogućuje proteolitičku razgradnju njegovog sadržaja da bi se stvorile male biomolekule za višekratnu upotrebu. 11, 12, 13 Autofagija se ne regulira kada su stanice pod stresom, poput gladovanja hranjivim tvarima ili hipoksije - uvjeta koji su uobičajeni u slabo vaskulariziranom okolišu tumora - omogućavajući tako nadoknadu hranjivih tvari i energije ili čišćenje citotoksičnih spojeva, U tom kontekstu, autofagija može pospješiti preživljavanje omogućavanjem privremene stanične prilagodbe nepovoljnim uvjetima; međutim, nakon kronične uvrede, ovaj proces može doprinijeti staničnoj smrti. 14, 15, 16

Jedan od poticaja koji može promicati autofagiju je stres na endoplazmatskom retikulu (ER). Iako su brojni efektori signalizacije uključeni u povezivanje ova dva procesa, precizni molekularni mehanizmi ostaju neizdrživi. 17, 18, 19, 20 Pobuđivači ER-stresa poput gladi hranjivih tvari dovode do nakupljanja nerazvijenih proteina unutar ER-lumena. 21, 22 Kao i autofagija, reakcija na stres na ER pokreće se za minimiziranje staničnog uvreda, u ovom slučaju zaustavljanjem globalnog prevođenja, smanjujući na taj način preopterećenje bjelančevina unutar ER-a. 23

Tri dobro okarakterizirana puta posreduju signalom ER stresa, koji se zajedno naziva neotkriveni protein proteina (UPR). 22, 23, 24 Glavni regulator UPR-a je protein 78 / BiP (regulirani glukozom reguliranim glukozom) koji rezultira ER-om (Grp78 / BiP). Akumulacija nerazvijenih proteina titra Grp78 / BiP od vezanja na luminalne repove ER transmembranskih proteina PRK-slične ER-kinaze (PERK), za inozitol potrebnu transmembransku kinazu / endonukleazu (IRE-1) i aktivirajući transkripcijski faktor 6 (ATF6). To omogućava autofosforilaciju PERK-a, koji zauzvrat fosforilira i inhibira faktor eukariotske inicijacije 2 α (eIF2 α ). Ova inhibicija, dok sprečava globalnu transformaciju mRNA, dopušta translaciju specifičnih gena za odgovor na stres koji su neovisni o ograničenju, kao što je ATF4 . 24 Drugo, disocijacija Grp78 / BiP rezultira premještanjem ATF6 u Golgi, pri čemu se aktivira proteolitičkim cijepanjem. 25. Konačno, IRE-1 autofosforilacija potiče spajanje mRNA proteina-1 (XBP-1) koji veže X-box na njegov kratki oblik, XBP-1. 26 Uzeti zajedno, aktivni transkripcijski faktori ATF6, XBP-1s i ATF4 reguliraju ekspresiju ER chaperona koji povećavaju sposobnost savijanja ER, uključujući sam Grp78 / BiP, kao i druge gene stresa kao što su CHOP i GADD34 . 22, 23 Iako je UPR adaptivni odgovor, kronični ER stres pojavit će se u staničnoj smrti. Nadalje, pokazalo se da autofagija izazvana stresom ili zahtijeva ili onemogućuje apoptozu na način ovisan o kontekstu, ističući osjetljivu međusobnu povezanost između ta dva procesa u određivanju sudbine stanica. 18, 19, 27

Ovdje smo identificirali novu ulogu androgena u modulaciji autofagije. Liječenje androgenom odgodilo je indukciju serumske gladovanja izazvane autofagijom povećavajući ekspresiju Grp78 / BiP, učinak koji je bio negativan srušenjem siRNA ovog proteina. Izmijenjena UPR signalizacija nije posredovala AR inhibiciji autofagije, sugerirajući da mogu postojati alternativni signalni putevi nizvodno od Grp78 / BiP za moduliranje ovog ključnog biološkog procesa. Kritično, dugotrajno liječenje androgenom značajno je odgodilo i početak autofagije i staničnu smrt u usporedbi sa stanicama izgladnjelih serumom bez androgena, a ovo kašnjenje u staničnoj smrti blokirano je grčenjem Grp78 / BiP. Ovi rezultati podržavaju novi mehanizam - modulaciju autofagije Grp78 / BiP - pomoću kojeg signalizacija AR-om može promicati prilagodbu gladi hranjivih tvari i zauzvrat izbjegavanje stanične smrti.

Rezultati

Liječenje androgenom blokira autofagiju uzrokovanu gladovanjem u serumu

Kako bismo modelirali održanu AR aktivaciju u uvjetima siromašnim hranjivim tvarima, utvrdili smo učinak mibolerona, sintetičkog agonista koji se ne može metabolizirati, na autofagiju izazvanu gladovanjem u serumu. 28 Poznato je da stimulacija AR-a od strane njegovih agonista inducira ekspresiju AR-a, dok androgena ablacija smanjuje razinu receptora. 29, 30 Da bi se potvrdila aktivacija AR miboleronom, LNCaP stanice su kultivirane 24 sata u mediju koji sadrži 10% goveđi serum fetusa (FBS), bez seruma (SF) medija ili bez seruma uz dodatak 10 ng / ml miboleron, liziran i zapadno izbrisan. Iako gladovanje u serumu dovodi do smanjenja AR ekspresije, stanice koje su tretirane miboleronom pokazale su razinu proteina AR sličnu onoj koja je zabilježena u stanicama koje se održavaju u FBS-u (Slika 1a). Ekspresija prostata specifičnog antigena ( PSA ), ciljni gen androgena, također je ocijenjena kao marker AR transkripcijske aktivnosti. 1 Slično, PSA ekspresija je posebno inducirana miboleronom, potvrđujući aktiviranje AR-a u prisutnosti ovog agonista (Slika 1a).

Image

Liječenje androgenom blokira autofagiju uzrokovanu gladovanjem u serumu. ( a ) Razine ekspresije receptora androgena (AR) i PSA u stanicama LNCaP održavane 24 sata u mediju koji sadrži 10% goveđi serum fetusa (FBS), medij bez seruma (SF) ili SF + 10 ng / ml mibolerona (SF + mib) ). Stanični lizati su zapadno izbrisani kako je naznačeno, s aktinom kao kontrolom opterećenja. ( b ) Reprezentativne konfokalne slike stanica koje prolazno izražavaju GFP-LC3, održavane kako je opisano u ( a ). ( c ) Kvantifikacija GFP-LC3 punkta-pozitivnih stanica prikazanih u ( b ). Pozitivna ćelija sadržavala je pet ili više punctae. Analizirano je pedeset stanica po stanju po pokusu. ( d ) Stanice su tretirane 0, 2 ili 6 h SF sredinom sa ili bez bafilomicina i / ili mibolerona. Lizati su zapadno izbrisani antitijelom protiv LC3, s aktinom kao kontrolom opterećenja. Lipidno konjugirani (LC3-II) i -nekonjugirani (LC3-I) oblici označeni su strelicama. Grafikon prikazuje denzitometrijsku analizu intenziteta pojasa LC3-II, normalizirane na razine aktina i izražene kao promjena nabora od netretirane kontrole. ( e ) Reprezentativne konfokalne slike stanica koje stabilno eksprimiraju mRFP-GFP-LC3 tretirane kako je opisano u ( a ). Spojene slike prikazuju prekrivanje GFP (zelena) i mRFP (crvena) slika. ( f ) Kvantifikacija mRFP + i mRFP + / GFP + punctae u stanicama prikazanima u ( e ), 25 stanica po uvjetu po pokusu. Za ( c ), ( d ) i ( f ), n = 3, trake pogrešaka označavaju srednje vrijednosti SE * P <0, 05 i ** P <0, 01, kako je naznačeno. Za ( b ) i ( e ) ljestvicu ljestvice = 20 nm

Slika pune veličine

Da bi se ispitao učinak mibolerona na autofagiju izazvanu gladovanjem u serumu, LNCaP stanice su inficirane adenovirusnim plazmidom koji kodira LC3 s oznakom GFP i ocijenjene konfokalnom mikroskopijom. LC3 je protein mikrotubule koji se lipidira i regrutuje u autofagosomsku membranu nakon indukcije autofagije. Kako bi potvrdili pravilno regrutovanje GFP-LC3, stanice su tretirane 6 sati bafilomicinom A, inhibitorom lizosomske protonske pumpe V-ATPaze. Ovo uznemiravanje lizosomske funkcije blokira autofagosomsku trgovinu, rezultirajući nakupljanjem autofagosoma. 31 U skladu s tim, stanice tretirane bafilomicinom pokazuju brojne GFP-LC3 punctae (dopunska slika S1).

U stanicama koje se održavaju u FBS-u GFP-LC3 pokazao je difuznu citoplazmatsku lokalizaciju, s nekoliko punctae, što odgovara niskoj bazalnoj razini autofagije u tim stanicama (slika 1b). Nakon gladovanja u serumu tijekom 24 sata, detektirane su brojne GFP-LC3 punctae; međutim, to nije uočeno u stanicama koje održavaju SF + miboleron (Slika 1b). Kvantifikacija je otkrila da je gladovanje u serumu značajno povećalo broj stanica pozitivnih na punctae, ali prisutnost mibolerona smanjila je taj broj na ono uporedivo s bazalnim razinama (Slika 1c).

Odsustvo GFP-LC3 punctae u serumu stanica izgladnjelih miboleronom tijekom 24 sata može ukazivati ​​na inhibiciju indukcije autofagije. 31 Da bi se istražila ta mogućnost, lipidiranje endogenog LC3 ocijenjeno je Western blotom, jer je lipidna konjugacija ovog proteina rezultirala elektroforetskim pomakom mobilnosti. 32 Stanice su tretirane 2 ili 6 sati u SF ili SF + miboleronu u prisutnosti ili odsutnosti bafilomicina A, da se omogući nakupljanje lipidiranog LC3, i lizirane. U stanicama koje nisu tretirane bafilomicinom A mogu se detektirati samo bazne razine lipidiranog (LC3-II) oblika, vjerojatno zbog velikog prometa LC3-II razgradnjom lizosoma ili depididacijom 31 (Slika 1d). Međutim, u prisutnosti bafilomicina A, detektirano je povećanje akumuliranog LC3-II u staničnim lizatima koji se održavaju u SF u usporedbi s onima u SF + miboleronu, što se pokazalo značajnim denzitometrijskom analizom (Slika 1d). Ovaj rezultat sugerira da miboleron utječe na tok autofagosoma u fazi indukcije.

Kako bismo potvrdili da miboleron blokira indukciju autofagije u stanicama izgladnjelih u serumu, željeli smo vizualizirati trgovinu autofhagosomima od indukcije do lizosomalne fuzije. Da bi to učinili, LNCaP stanice su stabilno zaražene plazmidom koji kodira LC3 koji je dvostruko obilježen mRFP i GFP. Kako je fluorescencija GFP-a osjetljiva na pH, taj se signal gubi nakon fuzije s kiselim lizosomalnim odjeljkom. mRFP fluorescencija, međutim, ne utječe, pa kolokalizacija GFP + i mRFP + punctae djeluje kao marker za (pre fuziju) autofagosom, dok punctae pozitivne na samo mRFP označavaju (post-fuzijski) autolizom. 33 Da bi se potvrdila očekivana lokalizacija mRFP-GFP-LC3, stanice su tretirane bafilomicinom A 6 h, nakon čega su pokazale gotovo potpunu kolokalizaciju GFP-a i mRFP (dopunska slika S2).

U skladu s prethodnim rezultatima (slika 1b), stanice koje eksprimiraju mRFP-GFP-LC3 pokazale su uglavnom difuznu lokalizaciju kada se 24 sata održavaju u FBS-u (slika 1e). Suprotno tome, gladovanje u serumu rezultiralo je stvaranjem i mRFP + / GFP + i mRFP + punctae, pokazujući održanu indukciju i promet autofagosoma do lizosomske fuzije, a kvantifikacija oba tipa puncta otkrila je da je to značajan učinak (slika 1e i f), Međutim, u stanicama izgladnjelih u serumu nadopunjenim miboleronom, primijetili smo broj obje vrste puncta usporedive s FBS-om (slika 1e i f). Ovi rezultati, uzeti zajedno s analizom LC3-II lipidiranja na slici 1d, potvrđuju da liječenje miboleronom blokira indukciju autofagije izazvane gladi u serumu.

Aktivacija receptora androgena blokira indukciju autofagije neovisno od cilja sisavaca signala rapamicina

Sisavska meta rapamicina (mTOR) djeluje kao ključni senzor aktivacije faktora rasta, raspoloživosti hranjivih tvari i energetskog statusa, a inhibicija ovog proteina inducira autofagiju. 34 Status aktivacije signalnog puta mTOR-a u stanicama izgladnjelim serumom određen je zapadnim mrljanjem fosforiliranog mTOR-a i njegovih nizvodnih efektora S6 kinaze, ribosomalnog proteina S6 i translacijskog faktora koji veže protein 4E-BP1. Kao što je predviđeno, fosforilacija mTOR-a i njegovih efektora su smanjeni nakon gladovanja u serumu u usporedbi sa stanicama koje se održavaju u FBS-u (slika 2a). Densitometrijska analiza potvrdila je da je ovo smanjenje statistički značajno (slika 2b).

Image

Androgen suzbija indukciju autofagije neovisno o mTOR signalizaciji. ( a ) Stanice koje su 24 sata održavane u SF medijumu ili s 10 ng / ml mibolerona (SF + mib), 1 μM rapamicina (SF + rapa) ili u kombinaciji (SF + mib + rapa) su lizirane i zapadne izbrisan s navedenim antitijelima, s aktinom kao kontrolom opterećenja. Sve ploče predstavljaju najmanje tri neovisna pokusa. ( b ) Grafikoni prikazuju denzitometrijsku analizu intenziteta pojaseva p-mTOR, p-S6K, p-S6 i p-4E-BP1, normaliziranih na ukupne razine proteina i izraženih kao promjena nabora od netretirane kontrole. ( c ) Reprezentativne konfokalne slike stanica koje prolazno eksprimiraju GFP-LC3, održavane 24 sata u naznačenim uvjetima. Linija mjerila = 20 nm. ( d ) Kvantifikacija GFP-LC3 punctae-pozitivnih stanica opisanih u ( c ). Pozitivna ćelija sadržavala je 10 ili više punctae. n = 3, 50 ćelija po uvjetu po eksperimentu, za ( b ) i ( d ), trake pogrešaka označuju srednju vrijednost SE In ( b ), ** P <0, 01 u odnosu na FBS; u ( d ), ** P <0, 01, kako je naznačeno; i # P <0, 01 u odnosu na FBS

Slika pune veličine

Hipotetizirali smo da mehanizam kojim miboleron blokira indukciju autofagije može biti reaktivacijom mTOR signala u stanicama izgladnjelih u serumu. Zanimljivo je da dodatak mibolerona nije povećao fosforilaciju mTOR-a i njegovih efektora u usporedbi sa stanicama koje su same gladirale u serumu (Slike 2a i b). Slično tome, mhibitor mTOR inhibitor rapamicin gotovo je u potpunosti blokirao fosforilaciju mTOR-a i njegovih nižih efektora u stanicama izgladnjelih u serumu, a dodavanje mibolerona nije pretjerano utjecalo na ovu inhibiciju (Slike 2a i b). Ovi rezultati sugeriraju da miboleron može djelovati na autofagijski put u mehanizmu neovisnom od mTOR-a.

Da bismo direktno istražili ulogu mTOR putanje u autofagiji, tretirali smo stanice rapamicinom radi promicanja autofagije i tada smo utvrdili da li dodavanje mibolerona može zaobići taj učinak. Stanice koje eksprimiraju GFP-LC3 tretirane su s FBS, SF ili SF + miboleronom sa ili bez rapamicina. Dodatak rapamicina, kako se predviđa, značajno je izazvao autofagiju u svim uvjetima (slika 2c i d). Međutim, kao što je primijećeno u kontroli, serumska gladovanje povećala je broj stanica koje su bile pozitivne na GFP-LC3 punctae iznad onih održanih u FBS-u, ali prisutnost mibolerona blokirala je to pojačanje (Slike 2c i d). To je potkrijepljeno opažanjem da je endogena lipidizacija LC3, određena Western blotom, pojačana u stanicama tretiranim rapamicinom, koje se održavaju u mediju bez seruma, u usporedbi s onima u miboleronu, što je učinak izražen u prisustvu bafilomicina A (S3). Uzeti zajedno, ovi rezultati pokazuju da je mehanizam kojim miboleron blokira indukciju autofagije uglavnom neovisan o mTOR-u, budući da je miboleron oslabio autofagiju izazvanu rapamicinom, bez utjecaja na aktiviranje mTOR putanje.

Učinak aktiviranja androgenih receptora na ER stres uzrokovan gladovanjem

Kako se može isključiti aktivacija mTOR-a kao mehanizma pomoću kojeg miboleron inhibira autofagiju, zatim smo istražili može li smanjenje stresa ER izazvano povlačenjem seruma poduprijeti ovu blokadu. U početku su procijenjene razine proteina i mRNA ER kapepena Grp78 / BiP, jer je ovaj protein uključen kao ključni posrednik autofagije uzrokovane ER stresom. 17 U stanicama izgladnjelih u serumu razina proteina Grp78 / BiP ostala je nepromijenjena unatoč značajnom povećanju mRNA (slike 3a i b). Suprotno tome, i Grp78 / BiP protein i mRNA bili su značajno regulirani u stanicama koje su tretirane miboleronom (Slike 3a i b). Ovaj rezultat povećava mogućnost da AR zaista može umanjiti reakciju na stres na ER povećavajući Grp78 / BiP prijevod ili stabilnost proteina i zauzvrat stabilizirajući ER. 17

Image

Učinak androgena na ER stres uzrokovan gladovanjem. Za sve ploče, stanice su održavane u FBS, SF ili SF + mibu za naznačene vremenske točke. Za ( a ), ( c ) i ( e ), stanice su lizirane i zapadno izbrisane navedenim antitijelima. Grafikoni prikazuju denzitometrijsku analizu intenziteta pojasa naznačenih proteina, normaliziranih na ukupnu razinu proteina i izraženih kao promjena nabora od netretirane kontrole. Za ( b ), ( d ) i ( f ), ukupna RNA je ekstrahirana i mRNA je kvantificirana RT-PCR i normalizirana na razine aktina ( b i d ) ili podvrgnuta 2% odvajanju agaroznog gela ( f ). ( a i b ) Ekspresija Grp78 / BiP proteina i mRNA. ( c ) Aktivacija eIF2 α i CHOP. ( d ) Razine mRNA ATF4. ( e ) Ekspresija i cijepanje proteina ATF6. Puni (90 kDa) i cijepani (50 kDa) obrasci ATF6 označeni su strelicama. n / s = nespecifični opseg. ( f ) spajanje XBP-1 mRNA. Puna duljina i spajanje XBP-1 označene su strelicama. Stanice tretirane 6 h s 2 µM thapsigarginom (TG) korištene su kao pozitivna kontrola. Sve ploče predstavljaju najmanje tri neovisna pokusa. Trake pogrešaka znače srednju vrijednost SE, * P <0, 05, ** P <0, 01 u odnosu na FBS ili kako je naznačeno. Za ( d ), * P <0, 05 SF + mib prema svim skupinama

Slika pune veličine

Kako bismo dalje istražili, istraživali smo učinak mibolerona na aktiviranje tri UPR signalne staze koje leže nizvodno od Grp78 / BiP. Prvo smo ispitali aktivaciju osi PERK-eIF2 α -ATF4. U stanicama izgladnjelim u serumu, eIF2 α fosforilacija je značajno porasla tijekom 2 sata i održavala se značajno iznad bazalnih razina do 24 sata (Slika 3c). ATF4 nije se mogao detektirati na razini proteina, vjerojatno zbog njegova kratkog poluživota 35 i nisu primijećene promjene u mRNA (Slika 3d). Međutim, razine proteina CHOP , ciljni gen ATF4, regulirane su za 24 sata (Slika 3c). Uzeto zajedno, ovi rezultati pokazuju aktiviranje osi PERK-eIF2 α -ATF4 nakon gladovanja u serumu. Suprotno tome, stanice dopunjene miboleronom pokazuju početnu eIF2 α fosforilaciju; međutim, to se nije održavalo u roku od 24 sata (slika 3c). U skladu s tim, razina mRNA ATF4 u ovim stanicama se smanjila i ekspresija proteina CHOP nije inducirana. Ovi rezultati sugeriraju da prisutnost mibolerona smanjuje aktivaciju ovog puta.

Zatim je ispitan drugi krak izraza i cijepanje UPR-a - ATF6. Ekspresija proteina 90-kDa pune duljine značajno je povećana za 24 sata u serumu stanica izgladnjelih miboleronom ili bez njega, a slično je otkriveno i usporediva razina cijepljenog oblika od 50 kDa (Slika 3e). To pokazuje da liječenje miboleronom nije utjecalo na serumsko gladovanje izazvano aktiviranjem ATF6. Konačno, procjena trećeg kraka UPR-a, spajanja XBP-1 mRNA posredovanog IRE-1, otkrila je da taj put nije aktiviran serumskom gladovanjem u tim stanicama (Slika 3f).

Stoga, dok serumska gladovanje aktivira oba PERK-eIF2 α -ATF4 i ATF6 staza, prisutnost mibolerona sprječava aktivaciju bivšeg i presudno dovodi do izrazite regulacije Grp78 / BiP. Uzeti zajedno, ovi rezultati povećavaju mogućnost da AR inhibiciju autofagije može biti posredovana izmjenama ER reakcije na stres.

Propadanje Grp78 / BiP smanjuje inhibiciju autofije posredovane androgenom

Kako je Grp78 / BiP kritični posrednik stabilnosti ER-a, pretpostavili smo da povećanje njegove ekspresije može biti podložno suzbijanju autofagije miboleronom. To smo riješili ciljanim rušenjem GrP78 / BiP od strane siRNA. Zabilježeno je da gotovo potpuno rušenje Grp78 / BiP dovodi do spontane aktivacije UPR-a i blokira autofagiju uzrokovanu stresom. 10, 36 Stoga smo htjeli koristiti koncentracije siRNA koje bi smanjile regulisanje proteina posredovanih miboleronom, ali ne bi promijenile bazalnu razinu autofagije. Stanice koje stabilno eksprimiraju mRFP-GFP-LC3 prethodno su tretirane s kontrolom ili Grp78 / BiP siRNA, a nakon 24 sata nakon transfekcije, serumski su gladovali sa ili bez mibolerona. Značajno oborenje Grp78 / BiP dobiveno je u stanicama FBS-a u usporedbi s odgovarajućim kontrolnim stanicama siRNA (slika 4a i b), a procjena stvaranja punkta potvrdila je da je Grp78 / BiP protein smanjen do razine koja ne inducira autofagiju (slika 4c). Važno je da je u stanicama tretiranim Grp78 / BiP siRNA mireleronima posredovana miboleronom značajno smanjena u usporedbi s kontrolama SF + mibolerona (Slika 4a i b).

Image

Srušenje Grp78 / BiP sprečava inhibiciju autofagije posredovane androgenom. ( a ) Kontrolne stanice sa siRNA i Grp78 / BiP-siRNA održavane su 24 sata u FBS, SF i SF + mib prije lize. Lizati su analizirani pomoću Western blot-a, s GAPDH-om kao kontrolom opterećenja. ( b ) Grafikoni prikazuju denzitometrijsku analizu intenziteta pojasa naznačenih proteina, normaliziranih na ukupne razine proteina i izraženih kao promjena nabora od netretirane kontrole. ( c ) Reprezentativne konfokalne slike stanica koje stabilno eksprimiraju mRFP-GFP-LC3 tretirane kako je opisano u ( a ). Spojene slike prikazuju prekrivanje GFP (zelena) i mRFP (crvena) slika. Linija mjerila = 20 nm. ( d ) Kvantifikacija mRFP + (desna ploča) i mRFP + / GFP + (lijeva ploča) punctae u ćelijama prikazanim u ( c ). n = 3, 25 stanica po uvjetu po pokusu. Za ( b ) i ( d ), trake pogreške označuju srednju vrijednost SE, * P <0, 05 i ** P <0, 01 u odnosu na FBS ili kako je naznačeno

Slika pune veličine

Zatim je utvrđen učinak knockdown-a Grp78 / BiP na AR supresiju autofagije. Stanice tretirane kontrolnom siRNA pokazale su autofagiju izazvanu gladovanjem koja je blokirana miboleronom (slika 4c i d). Nakon rušenja Grp78 / BiP, autofagija izazvana gladovanjem u serumu bila je usporediva s onom opaženom u kontrolnim siRNA stanicama (Slika 4c i d). Međutim, miboleron nije bio u stanju inhibirati autofagiju u obrušavajućim stanicama Grp78 / BiP, a kvantifikacija mRFP + / GFP i mRFP + punctae otkrila je da su autofagosomi inducirani i preprodani lizosomima u sličnom opsegu kao što su stanice gladile samo u glavi (Slika 4c i d). To pokazuje da je obustava Grp78 / BiP dovoljna da se zaustavi miboleron posredovana inhibicija autofagije i potvrđuje da je regulacija ovog proteina androgenima podložna modulaciji autofagije.

Inhibicija androgena autofagije nije posredovana eIF2 α deposforilacijom

Kao što smo primijetili oslabljenu signalizaciju puta p-eIF2 α -ATF4-CHOP u stanicama koje su tretirane miboleronom (slika 3c i d), pretpostavili smo da je ovo možda izravni rezultat neregulisanog Grp78 / BiP, čime se sprječava dimerizacija i aktiviranje PERK-a, Da bismo dalje istražili, ispitali smo hoće li obor Grp78 / BiP ukinuti eIF2 α dephosforilaciju primijećenu nakon liječenja miboleronom. U FBS i SF stanicama, Grp78 / BiP pad značajno je povećao razinu p-eIF2 α , što se i očekivalo (slike 4a i b). Međutim, iznenađujuće, opazili smo značajno smanjenu fosforilaciju eIF2 α u stanicama tretiranim miboleronom u usporedbi sa samo gladovanjem u serumu, čak i pri padu Grp78 / BiP (slika 4a i b). Ovo defosforilacija može biti posljedica rezidualne regulacije Grp78 / BiP miboleronom u obrušavajućim stanicama ili može predstavljati mehanizam AR-modulacije eIF2 α neovisan o Grp78 / BiP. Međutim, kako je autofagija značajno inducirana miboleronom u obrušavajućim stanicama Grp78 / BiP usprkos smanjenoj fosforilaciji eIF2 α , to sugerira da atenuirana signalizacija ove osi UPR ne podliježe regulaciji autofagije posredovane AR-om.

Da bismo posebno istražili ulogu eIF2 α fosforilacije u inhibiranju autfagije pomoću androgena, zajedno smo tretirali stanice s 50 μM salubrinala, inhibitorom CReP / GADD34 / PP1 kompleksa odgovornim za eIF2 α deposforilaciju. 37 Tretman salubrinalnim značajno povećao razinu p-eIF2 α u svim skupinama, dok su kontrolne stanice pokazale samo aktiviranje serumske gladi (Slika 5a i b). Važno je da salubrinalni tretman nije utjecao na regulaciju Grp78 / BiP posredovanu miboleronom, što je omogućilo neovisnu procjenu učinaka eIF2 α manipulacije (slike 5a i b).

Image

Blokiranje eIF2 α deposforilacije salubrinalom ne smanjuje inhibiranje autofagije posredovane androgenom. ( a ) Stanice tretirane 24 sata u FBS, SF ili SF + mib s 50 μM salubrinalne ili DMSO kontrole veziva su lizirane i zapadno izbrisane navedenim antitijelima. Aktin je korišten kao kontrola opterećenja. ( b ) Grafikoni prikazuju denzitometrijsku analizu intenziteta pojasa naznačenih proteina, normaliziranih na ukupne razine proteina i izraženih kao promjena nabora od netretirane kontrole. ( c ) Reprezentativne konfokalne slike stanica tretiranih kako je opisano u ( a ). Linija mjerila = 20 nm. ( d ) Kvantifikacija GFP-LC3 punkta-pozitivnih stanica prikazanih u ( c ). Pozitivna ćelija sadržavala je pet ili više punctae. n = 3, 50 stanica po uvjetu po eksperimentu, za ( b ) i ( d ), trake pogrešaka označuju srednju vrijednost SE, * P <0, 05 i ** P <0, 01 kako je naznačeno; # P <0, 01 u odnosu na FBS

Slika pune veličine

Zanimljivo je da je salubrinalnim liječenjem inducirana autofagija u svim skupinama, o čemu svjedoči značajno povećanje broja GFP-LC3 punkta-pozitivnih stanica u usporedbi s kontrolom (Slika 5c i d). Međutim, iako je bazna razina autofagije bila povećana salubrinalnom, primijetili smo da gladovanje u serumu dodatno povećava broj pozitivnih stanica i da taj učinak nije bio prisutan u prisutnosti mibolerona (slika 5c i d). Stoga, održavana fosforilacija eIF2 α nije dovoljna da blokira inhibiciju autofagije miboleronom.

Uzeto zajedno, ovi rezultati sugeriraju da iako aktiviranje AR-a može modulirati fosforilaciju eIF2 α i naknadnu aktivaciju njegovih efektora (slika 3c i d), ovaj put nije uključen u AR-posredovanje inhibicije autofagije.

Kronično gladovanje u serumu u prisustvu androgenih kašnjenja, ali ne suzbija indukciju autofagije

Kako je utvrđeno da miboleron može blokirati autofagiju izazvanu gladovanjem do 24 sata, istražili smo zadržava li ovaj učinak i nakon kroničnog gladovanja u serumu. To je procijenjeno kvantificiranjem mRFP + / GFP + i mRFP + punctae u stanicama koje eksprimiraju mRFP-GFP-LC3 do 96 h serumske gladovanja sa ili bez mibolerona (Slika 6a-c). Zanimljivo je da se u stanicama izgladnjelih u serumu prosječni broj punctae vremenom malo povećao, što sugerira da brzina autofagosomske indukcije i prometa raste polako i stabilno. Suprotno tome, serumi stanica izgladnjelih u prisustvu mibolerona pokazuju brzi porast brzine indukcije autofagije i prometa, sa značajnim povećanjem i mRFP + / GFP i mRFP + punctae uočenih između svake točke do 72 h (slika 6a-c), Pored toga, endogena razina LC3 i lipidizacija su regulirani u oba stanja tijekom 96 h (slika 6d). Ovaj rezultat pokazuje da inhibicija autofagije miboleronom u roku od 24 sata predstavlja odlaganje početka ovog procesa, a ne apsolutno suzbijanje, i za 96 h ove stanice pokazuju usporedivu autofagičku aktivnost jer stanice u serumu gladuju same.

Image

Androgen odgađa autofagiju uzrokovanu kroničnim gladovanjem. ( a i b ). Vremenski tijek indukcije autofagije i prometa u stabilnim stanicama mRFP-GFP-LC3. Kvantifikacija mRFP + / GFP + ( a ) i mRFP + ( b ) punctae u stanicama koje se održavaju u SF ili SF + mib tijekom 24, 48, 72 i 98 h. Dvadeset i pet stanica je analizirano po uvjetu po eksperimentu, n = 3, šipke pogreške ukazuju na srednju vrijednost SE, * P <0, 05. ( c ). Reprezentativne konfokalne slike stanica koje se održavaju u FBS mediju ili nakon 96 h SF ili SF + mib. Spojene slike prikazuju prekrivanje GFP (zelena) i mRFP (crvena) slika. Linija mjerila = 20 nm. ( d ) Stanice su tretirane kako je opisano u ( a ), lizirane i podvrgnute Western blot analizi sa naznačenim antitijelima. Sve ploče predstavljaju tri neovisna pokusa

Slika pune veličine

Da bi se potvrdilo da pojava autofagije u stanicama liječenim miboleronom nije uslijed smanjenja učinkovitosti ovog nemetabilnog lijeka, razina AR i PSA ispitivala je Western blot (slika 6d). Ekspresija AR i PSA bila je usporediva s razinama opaženim u FBS stanicama i bila je znatno veća od one u stanicama koje su same gladirale. Stoga je smanjenje učinkovitosti lijeka isključeno kao objašnjenje indukcije autofagije.

Kako je utvrđeno da je obor Grp78 / BiP dovoljan da se omogući autofagija u stanicama liječenim miboleronom, mi smo obrazložili da promjene u ekspresiji ovog proteina mogu biti podloga početka autofagije opažene u kasnijim vremenskim točkama. Doista, razina Grp78 / BiP opadala je s vremenom i bila su usporediva s onim viđenim u SF stanicama za 72 h (Slika 6d). To je povezano s indukcijom i povećanjem autofagije u stanicama koje su tretirane miboleronom (slika 6a-c), podupirući hipotezu da modulacija autofagije miboleronom posreduje Grp78 / BiP.

Grp78 / BiP blokira zaustavljanje odumiranja stanica posredovanih androgenom

Da bi se utvrdila posljedica dugotrajnog gladovanja u serumu, stanice su održavane kao na slici 6a i podvrgnute analizi stanične smrti pozitivnošću propidijum-jodida (PI). Iako izgladnjivanje serumom nije u početku uzrokovalo staničnu smrt, nakon 72 h ove ćelije su pokazale značajno povećanje postotka PI-pozitivnih stanica u usporedbi s bazalnom razinom, učinak koji nije primijećen u stanicama tretiranim miboleronom (Slika 7a). Međutim, već od 96 h količina stanične smrti koja se opaža u oba stanja bila je usporediva (slika 7a). To pokazuje da kronično gladovanje u serumu izaziva staničnu smrt i ta indukcija odgađa, ali ne i suzbija miboleron.

Image

Androgen odgađa staničnu smrt uzrokovanu kroničnim gladovanjem. ( a ) Vremenski tijek stanične smrti stanice održava se u FBS, SF ili SF + mibu tijekom 24, 48, 72 ili 96 h. Stanična smrt procijenjena je bojenjem živih stanica s PI prije FACS analize. ( b ) Stanice su transficirane kontrolnom ili Grp78 / BiP siRNA tijekom 24 sata, a zatim obrađene daljnjih 72 h FBS, SF ili SF + mib i analizirane kao u ( a ). n = 3, trake pogreške pokazuju prosjek SE * P <0, 05 i ** P <0, 01 kako je naznačeno; # P <0, 05 nasuprot odgovarajućoj kontroli

Slika pune veličine

Kako smo utvrdili da Grp78 / BiP posredovana inhibicija autofagije u stanicama tretiranim miboleronom (slika 4c i d), razmotrili smo da li ovaj protein također posreduje kašnjenju stanične smrti. Proučavali smo smrt u roku od 72 sata, jer je u ovom trenutku opažena značajna razlika između stanica izgladnjelih sa miboleronom ili bez njega (slika 7a). Kao što se i očekivalo, procjena pozitivnosti PI u stanicama kontrolnih siRNA pokazala je da je miboleron smanjen smrtnom pobudom u serumu. Međutim, Grc78 / BiP obustava ukinula je ovaj inhibitorni učinak AR aktivacije (slika 7b). Ovaj rezultat pokazuje da kašnjenje u staničnoj smrti uzrokovano miboleronom posreduje početnom regulacijom Grp78 / BiP. Uzeto zajedno, ovi nalazi zajedno ističu da je ovaj protein kapelena neophodan za djelovanje na dva kritična biološka procesa - autofagiju i preživljavanje - nizvodno od aktiviranog AR-a.

Rasprava

U ovom istraživanju smo ustanovili da AR aktivacijom ukida autofagiju izazvanu akutnom gladovanjem u serumu. Izvješćujemo novo otkriće da u tom kontekstu liječenje androgenima ne inhibira autofagiju pokretanjem signala mTOR, već djeluje uregulacijom Grp78 / BiP, ključnog posrednika ER stabilnosti. Presudno je da pokazujemo da je prilagodba na androgene gladovanjem u serumu privremena, jer nakon dužeg povlačenja seruma stanice liječene androgenima pokazuju odlaganje, a ne potiskivanje, autofagije i stanične smrti, događaje koji se povezuju sa smanjenjem Grp78 / BiP razina proteina. Konačno, obustava ovog proteina od početka serumske gladi ukida prednost preživljavanja pružene dodavanjem androgena, uspostavljajući definitivnu ulogu za Grp78 / BiP kao ključni učinak signalizacije AR-a.

Oligonukleotidni nizi i proteomska analiza stanica raka prostate liječenih androgenom otkrili su regulaciju nekoliko ER kaperona i rezidentnih proteina, uključujući Grp78 / BiP. 38, 39, 40, 41, 42, 43, 44 Imunohistokemijska ispitivanja uzoraka raka prostate kod ljudi pokazuju da je pojačana ekspresija Grp78 / BiP povezana s agresivnim oblicima bolesti i prostata specifična za prostatu ovog proteina blokira tumorigenezu u PTEN- nulti model miša, sugerira ključnu ulogu Grp78 / BiP u razvoju raka prostate. 45, 46, 47 Međutim, izravni funkcionalni odnos između AR i Grp78 / BiP nije istražen, i unatoč značajnim dokazima o ulozi androgena u regulaciji ER, ovo je prvo izvješće koje opisuje utjecaj na UPR signalizacija.

Zanimljivo je da je od dva proksimalna UPR puta aktivirana gladovanjem u serumu, samo PERK-eIF2 α -ATF4 aktivacija umanjena androgenom, dok cijepanje ATF6 nije utjecalo. Mehanizmi koji stoje na osnovi ove razlike nisu jasni; međutim, naši dokazi sugeriraju da se inhibicijski učinak androgena na PERK-eIF2 α -ATF4 put može dogoditi neovisno o regulaciji Grp78 / BiP (slika 4a i b). To povećava mogućnost da dodatna razina unosa AR na ovaj put može postojati, na primjer, promjenom profila ekspresije proteina koji borave izvan ER lumena, koji reguliraju PERK ili eIF2 α . Međutim, iz naših rezultata jasno je da modulacija ovog puta nije potrebna da AR izvršava svoje inhibicijske učinke na indukciju autofagije, za razliku od regulatora gornje struje, Grp78 / BiP. Ovo naglašava kritično pitanje s obzirom na ulogu regulacije Grp78 / BiP. Ako ovo povećanje ekspresije proteina ne djeluje na suzbijanje UPR signalizacije, onda kojim mehanizmom on regulira autofagiju? Nekoliko izvještaja identificiralo je Grp78 / BiP lokalizaciju na plazma membrani ili citosolu, sugerirajući višestruke uloge izvan ER stabilnosti i UPR modulacije. 48, 49, 50 U tijeku su daljnji eksperimenti kako bi se razjasnili potencijalni signalni mehanizmi pomoću kojih se ovaj protein može ubaciti u autofagijski put.

Promatranje da androgen inhibira autofagiju putem Grp78 / BiP regulacije, a ne aktiviranjem mTOR signalizacije novo je otkriće s obzirom da prethodna izvješća pokazuju da AR aktiviranje može pozitivno utjecati na ovaj ključni signalni čvor. 10, 51 Međutim, čini se da utjecaj AR-a na aktivnost mTOR-a ovisi o energetskom i hranjivom stanju stanice. Na primjer, DHT stimulacija dovela je do aktiviranja mTOR signalizacije u LNCaP stanicama koje se održavaju u mediju sa serumom osiromašenim steroidima. 51 U uvjetima izgladnjelih u serumu, sinteza proteina je blokirana, što je u našem modelu dokazano smanjenjem signala mTOR i fosforilacijom eIF2 α , čime se inhibira biosneza ribosoma i pokretanje translacije. 52 Da su AR ciljni geni PSA i AR izraženi tokom liječenja miboleronom ilustrira sposobnost AR da pokrene sintezu proteina specifičnih gena čak i u uvjetima siromašnih hranjivim tvarima, a naši rezultati sugeriraju da se to može dogoditi slabljenjem translacijske inhibicije modulacijom eIF2 α fosforilacija, a ne reaktivacijom mTOR. Slično tome, opažamo da miboleron smanjuje autofagiju izazvanu rapamicinom, a istovremeno ne utječe na aktivaciju mTOR-a, ističući da su suprotni učinci na autofagiju potaknuta tim dvama spojevima različiti mehanizmi. Ovo zapažanje podržavaju Wang i sur. , 53 koji su istraživali apoptotičke učinke rapamicina i AR antagonista bikalutamida i otkrili da mTOR i AR utječu na preživljavanje paralelnim, a ne preklapajućim se putevima. Zajedno, jasno smo pokazali da AR aktivacija može ispoljiti stanične učinke neovisne o mTOR-u.

Jedna posljedica adaptacije androgena na stres izazvan gladovanjem bila je inhibicija autofagije; međutim, ova je prilagodba samo privremeno odmorila. Autofagija je katabolički proces, dok androgeni izravno promiču nekoliko dobro karakteriziranih anaboličkih puteva, poput lipogeneze i pojačane uporabe glukoze. 54, 55 U našem modelu, neto učinak ova dva suprotstavljena podražaja - serumska gladovanje i AR aktivacija - bio je kašnjenje indukcije autofagije. S obzirom da je ishod signalizacije AR-a anabolički, početni porast nivoa Grp78 / BiP može odražavati prilagodbu povećanoj sintezi proteina kako bi se izbjeglo preopterećenje ER-om. Međutim, nakon kroničnog gladovanja u serumu, primijetili smo i smanjenje razine Grp78 / BiP i povećanje smrtnosti stanica. Čini se da prelazak između adaptacije na stres i smrti leži u selektivnoj stabilnosti mRNA za preživljavanje i proteina (tj. Grp78 / BiP i ostalih ER chaperona) u usporedbi s onima koji promiču apoptozu (tj. CHOP). 21, 22, 35 Ovo je u našem modelu ponovljeno kao sprečavanje androgena posredovane regulacije Grp78 / BiP od početka serumske gladovanja siRNA negiranjem bilo kakve prednosti preživljavanja dodavanja androgena.

Ovi rezultati imaju kritične posljedice s obzirom na mehanizme pomoću kojih signalizacija AR-a doprinosi izbjegavanju stanične smrti in vivo . Ekstrapolacija naših rezultata za modeliranje mikrookoljenog tumora siromašnog hranjivim tvarima sugerira da održavana signalizacija AR-a, bilo lokalnom ili sistemskom proizvodnjom androgena, mutacijom, unakrsnim razgovorom ili drugim mehanizmima, potiče akutnu prilagodbu hranjivih tvari izgladnjivanjem, pružajući tako početnu prednost preživljavanja, 1, 56 We can attribute this to AR-stimulated upregulation of Grp78/BiP, providing a novel mechanistic hypothesis for the observed correlation of high protein levels with aggressive forms of the disease. According to our results, maintained AR signalling will not overcome the deleterious effects of chronic starvation, arguing for the requirement for multiple genetic changes to promote androgen-independent prostate cancer. However, our results highlight a novel mechanism whereby AR may contribute to the progression to this phenotype by allowing for temporary adaptation to cellular stress.

Materijali i metode

Cell culture protocols, transfections and reagents

The human prostate cancer cell line LNCaP was obtained by American Type Culture Collection (ATCC). Cells were maintained in RPMI 1640 (Gibco, Invitrogen, Paisley, UK) supplemented with 10% FBS (Harlan, Indianapolis, IN, USA) and 2 mM L -glutamine (Gibco) at 37°C and 5% CO 2 . For serum starvation experiments, cells were washed twice in PBS, and then maintained in phenol red-free RPMI 1640 supplemented with 2 mM L -glutamine. For GFP-LC3 expression, subconfluent LNCaP cells were infected with an adenoviral vector encoding GFP-LC3 fusion, a kind gift of Aviva Tolkovsky (University of Cambridge, Cambridge, UK). At 24 h post-infection, cells were washed with fresh medium before treatment. For construction of the pWZL-mRFP-GFP-LC3 expression vector, mRFP-GFP-LC3 fragment 33 was isolated by Nhee 1– Sal 1 digest and inserted into Sna B1/ Sal 1-digested pWZL-HYGRO plasmid. For the establishment of stable cell lines, subconfluent cells were harvested and subjected to nucleofection with Nucleofector Kit R (Lonza, Basel, Switzerland), according to the manufacturer's instructions. Cells were selected according to hygromycin B resistance (100 μ g/ml). Thapsigargin, bafilomycin A, rapamycin, hygromycin and PI were all purchased from Sigma (St Louis, MO, USA); mibolerone from PerkinElmer (Boston, MA, USA); and salubrinal from Tocris (Ellisville, MI, USA).

Western blotting

Cells were washed in ice-cold PBS before lysis with 2 × Laemmli buffer containing 10% β -mercaptoethanol. Lysates were boiled for 10 min at 95°C, proteins were separated using 15% or 4–12% SDS-PAGE (Invitrogen) and transferred to polyvinylidene difluoride (Immobilon-P, Millipore, Bedford, MA, USA). Membranes were blocked in 5% skim milk powder/TBS-Tween-20 and incubated in primary antibody overnight at 4°C. After washing, membranes were incubated in secondary antibody for 1 h at room temperature and visualized with chemiluminescence detection (GE Healthcare, Buckinghamshire, UK) on autoradiographic film (Fuji, Bedfordshire, UK). Densitometric analysis was performed on scanned autoradiographs using the Image J software (version 1.40g).

Primary antibodies used in this study were purchased from Sigma (actin, clone AC-40; GAPDH-peroxidase, clone GAPDH-71.1); Cell Signalling Technology, Danvers, MA, USA (CHOP, clone L63F7; phospho-mTOR (S2448); phospho-eIF2 α (S51), clone 119A11; phospho-4EBP1 (S65), clone 174A9; phospho-p70 S6 kinase (T421/S424); phospho-PERK (T980), clone 16F8; Grp78/BiP, clone C50B12; phospho-S6 (S235/6), clone 2F9; p70 S6 kinase; mTOR; S6); Imgenex, San Diego, CA, USA (ATF6); Novus, Littleton, CO, USA (LC3); and Santa Cruz (AR; PSA, clone C-19). Secondary antibodies used were anti-mouse, anti-rabbit and anti-sheep IgG-HRP conjugate from Cell Signalling Technology.

siRNK

siRNA oliogonucleotides used in this study were purchased from Thermo Scientific, Waltham, MA, USA. For siRNA uptake, cells were nucleofected using Nucleofector Kit R (Lonza) according to the manufacturer's instructions. At 24 h post-nucleofection, the medium was changed to treatment conditions for the indicated time.

Konfokalna mikroskopija

To visualize punctae in GFP-LC3- or mRFP-GFP-LC3-expressing cells, cultures were fixed in 4% paraformaldehyde, washed in PBS and mounted in Vectashield (Vector Laboratories, Burlingame, CA, USA). Cells were visualized using an Olympus FV-1000 confocal microscope under × 63 objective and analysed using the Image J software (version 1.40g).

Q-RT-PCR

Subconfluent cells were harvested and RNA extracted using RNeasy Mini Kit (Qiagen, Hilden, Germany). Synthesis of cDNA and PCR amplification from total RNA was performed using DyNAmo SYBR Green 2-step qRT-PCR kit (Finnzymes, Espoo, Finland) and MJ Research Peltier Thermal Cycler apparatus (Bio-Rad, Hercules, CA, USA). Quantification was determined using the MJ Opticon Monitor 3 analysis software, version 3.1 (Bio-Rad). The following primers were used for qRT-PCR: ATF4 – GGGACAGATTGGATGTTGGAG A (sense), ACCCAACAGGGCATCCAAGT (antisense); Grp78/BiP – CATGGTTCTCACTAAAATGAAAG (sense), GCTGGTACAGTAACAACTG (antisense); XBP1 – CTGGAACAGCAAGTGGTAGA (sense), CTGGGTCCTTCTGGGTAGAC (antisense); and β -actin – AAGATCAAGATCATTGCTCCTCCT (sense), TCATAGTCCGCCTAGAAGCA (antisense). Primers for ATF4 and Grp78/BiP were purchased from Invitrogen and XBP-1 and β -actin from VHBio (Newcastle, UK).

Analiza stanične smrti

For determination of cell death, adherent and floating cells were collected, pelleted and resuspended in 0.1 mg/ml PI. Cells were analysed according to fluorescence intensity using the FACSCaliber flow cytometer and Cell Quest software, version 5.2.1 (BD Bioscience, San Jose, CA, USA).

Statistička analiza

Statistical analysis was performed using the unpaired Student's t -test, with differences of P <0.05 considered to be statistically significant.

Dodatna informacija

PDF datoteke

  1. 1.

    Dopunske brojke

Word dokumenti

  1. 1.

    Legenda dopunskih figura

Glosar

Grp78/BiP

glucose-regulated protein 78/BiP

ER

endoplazmatski retikulum

mTOR

mammalian target of rapamycin

eIF2 α

eukaryotic initiation factor 2 α

POVLASTICA

PRK-like ER kinase

IRE-1

inositol-requiring transmembrane kinase/endonuclease

ATF4, 6

activating transcription factor 4, 6

XBP-1

X-box-binding protein-1

JU

propidijev jodid

Dodatne informacije prate rad na web stranici Cell Cell and Disease (//www.nature.com/cddis)