Potpun gubitak funkcije ubikvitin ligaze herc2 uzrokuje teški neurorazvojni fenotip | europski časopis za ljudsku genetiku

Potpun gubitak funkcije ubikvitin ligaze herc2 uzrokuje teški neurorazvojni fenotip | europski časopis za ljudsku genetiku

Anonim

teme

  • Genetika bolesti
  • bolesti

Sažetak

Put ubikvitin-proteasoma uključen je u patogenezu nekoliko neurogenetskih bolesti. Opisali smo mavretanskog pacijenta koji ima homozigotnu deleciju ograničenu na dva susjedna gena HERC2 i OCA2 i predstavlja ozbiljne poremećaje u razvoju. Brisanje uzrokuje potpuni gubitak funkcije proteina HERC2, ligaze E3-ubikvitina. Poznato je da HERC2 cilja XPA i BRCA1 zbog razgradnje i mehanizam koji uključuje u obnavljanje DNK i regulaciju staničnog ciklusa. Pokazali smo da gubitak funkcije HERC2 dovodi do nakupljanja XPA i BRCA1 u pacijentovim fibroblastima i stvara smanjenu osjetljivost na apoptozu i povećanu razinu popravka DNK. Naši podaci prvi put opisuju fenotipske posljedice, na kliničkoj i staničnoj razini, potpunog gubitka funkcije HERC2 kod pacijenta. Oni snažno sugeriraju da je duboka disfunkcija povezana s ubikvitin ligazom odgovorna za teški fenotip ovog pacijenta i da disfunkcija ovog puta može biti uključena u druge bolesnike sa sličnim neurorazvojnim bolestima.

Uvod

HERC2 (HECT domena i domena 2 slična RCC1, MIM 605837, NM_004667.4) je pigmentacijski nepovezan gen smješten 11, 7 kb uzvodno od OCA2. Mutacije OCA2 gena odgovorne su za nesindromni okulokutani albinizam tipa 2. OCA2 obuhvaća 345 kb u 15q11.2-q12 i sadrži 25 eksona. On kodira P protein koji je membranska komponenta melanosoma koji bi mogao biti uključen u regulaciju pH melanosoma, bitan faktor u različitim fazama proizvodnje melanina i, posebno, relativnom količinom količine eumelanina i feomelanina. Delecije predstavljaju 14, 5% OCA2 mutacija. 1 Nizovi homologni HERC2 genu čine ponavljanja u maloj kopiji povezana s prijelaznim točkama kromosomskih preuređenja smještenih u 15q11–15q13. 2 HERC2 kodira 528 kDa E3 ubikvitin ligazu, koja djeluje s E6AP / UBE3A, drugom ubikvitin ligazom i cilja BRCA1 i XPA za razgradnju. 3, 4, 5 Donedavno mutacije HERC2 nisu bile povezane s ljudskim poremećajem. U posljednje vrijeme, pronađena je pojedinačna homozigotna mutacija HERC2 u obitelji Amiša starog reda s neurorazvojnim poremećajem koji ima neke fenotipske sličnosti s Angelmanovim sindromom. 6, 7

Ovdje predstavljamo prethodno neopisani fenotip u afričkog pacijenta koji se predstavlja s OCA i teškim neurološkim i razvojnim poremećajem povezanim s velikom homozigotnom delecijom koja uključuje dva susedna gena OCA2 i HERC2 .

Materijali i metode

Array-CGH

Mikroračun je posebno dizajniran za traženje delecija u OCA1-4 genima, kao što je već opisano. 1 Varijanta je pohranjena u mutacijskoj bazi LOVD HERC2 (//www.LOVD.nl/HERC2). Podatkovna iskaznica pacijenta iznosi 00072301.

Redoslijed točke prekida brisanja

Primeri korišteni za pojačavanje prijelomne točke brisanja kod pacijenta bili su 5'GTAGCTACTAAAATGAATTGGACAAA3 'i 5'ATGAACTTTATAAGCAGCAAAGCA3'. Oba lanca dvaju PCR fragmenata sekvencionirana su korištenjem prajmera koji su korišteni za PCR amplifikaciju pomoću Big Dye v1.1 kompleta na ABI3130xl sekvenceru (Applera, Courtaboeuf, Francuska). PCR i slijed biciklističkih uvjeta dostupni su od autora na zahtjev. Analiza sekvence koja okružuje točke prekida brisanja provedena je korištenjem softwares NCBI BLAST2 za pretraživanje homologije sekvenci i RepeatMasker za otkrivanje ponavljajućih sekvenci (NCBI, BLAST2, //www.ncbi.nlm.nih.gov/ blast / bl2seq / bl2.html ; RepeatMasker, //www.repeatmasker.org/). Pristupni brojevi korištenih sekvenci gena HERC2 i OCA2 bili su RefSeq NG_016355.1 (NM_004667.4) i NG_009846.1 (NM_000275.2).

RNA studije

Ukupna RNA ekstrahirana je iz stanica ili tkiva pomoću Trizola. Pojačanja qPCR-a u stvarnom vremenu izvedena su kako je prethodno opisano. 8 Ukratko, PCR reakcije su sadržavale 1X iQ SYBR Green Supermix (Biorad, Steenvoorde, Francuska), dva prajmera potrebna za amplifikaciju i bilo 50 ng ukupne DNK ili cDNA iz 100 ng reverzno prepisane ukupne RNA. Slijed primera bio je sljedeći. Ulomak HERC2-1 (obuhvaća HERC2, egzoni 5 i 7): 5 'CGGTATTTCTCTGCCTCCTG3', 5'ACTCCTGCAACAGCTCACTG3 '. Ulomak HERC2-2 (obuhvaća HERC2 egzoni 90 i 91): 5'ACACACATCACCCTGGACAA3 ', 5'CCGGTGAACAGAGAGAGAGAGAGAG'. Ulomak OCA2-23 (obuhvaća OCA2 egzoni 23 i 24): 5 'TGGATATGGGTTCTCCTTCA3', 5'ACACATCCCAACAGTGCAG3 '. Fragment HERC2-OCA2 (koji se proteže od HERC2 egzona 56 i OCA2 egzona 20 u fukcijskoj RNA HERC2-OCA2 ): 5'ATCCATGGTCTCATCCTGCT3 ', 5'ACACATCCCAACAGTGCAG3'. RPLP0 mRNA služila je kao unutarnja kontrola za normalizaciju. Uvjeti za PCR dostupni su od autora na zahtjev.

Studije o proteinu

Stanična kultura

Pacijentski i kontrolni fibroblasti održavani su na 37 ° C i 5% C02 u mediju DMEM (Gibco, Life Technologies, Grand Island, NY, USA) uz 10% fetalnog goveđeg seruma i antibiotika. Stanice su uzgajane do 90–100% konfluencije u tikvicama T75 stanične kulture.

fosforilacija

Stanice su prenesene u ploču s četiri jažice radi fiksacije. Stanice na pokrivačima su fiksirane 30 minuta u 4% paraformaldehidu u PBS-u, permealizirane su i blokirane 60 minuta s 0, 3% Triton X-100 i 3% normalnim kozjim serumom u PBS-u i inkubirane sa specifičnim antitijelima 1 sat na sobnoj temperaturi (RT ): monoklonski anti-HERC2, čiji se epitop nalazi unutar predviđenog fuzijskog proteina HERC2-OCA2 (aa 1781-1974; 1: 500, BD Biosciences, San Jose, CA, SAD); poliklonski anti-Ubi-Lys48 (1: 500; Millipore, Temecula, Kalifornija, SAD); monoklonalni anti-BRCA1 (1: 500; Abcam, Cambridge, Velika Britanija). Nakon ispiranja s PBS-om, stanice su inkubirane 1 sat na RT kod konjugiranog kozjeg anti-mišjeg IgG 1 konjugiranog AlexaFluor 488 i AlexaFluor 568 konjugacije (1: 500; Life Technologies). Poklopac se zatim ispere tri puta pet minuta s PBS-om i postavi se sa DAPI koji sadrži Prolongold (4 ', 6 oui-diamidino-2-fenilindol; Life Technologies). Slike su dobivene pomoću mikroskopa AxioVision (Zeiss, Göttingen, Njemačka) s ciljem 63. Analize kolokalizacije provedene su korištenjem dodatka Analiza korelacije intenziteta s softvera MacBiophotonics ImageJ.

Određivanje kinetike popravljanja 6-4PP i CPD

Kinetika popravljanja ispitana je kao što je prethodno opisano. 9 Ukratko, eksponencijalno rastući asinkroni fibroblasti bili su izloženi UVB u dozi od 50 mJ cm2 pomoću Biotronic uređaja (Vilber Lourmat, Marne la Vallée, Francuska), opremljenog dozimetrom, u kojem je UVB žarulja emitirala kontinuirani spektar između 280 i 380 nm (glavni vrh na 312 nm). U različitim vremenskim intervalima nakon ozračenja, stanice su fiksirane s 4% formaldehida 10 minuta na sobnoj temperaturi, a zatim permealizirane preko noći u hladnom 70% -tnom etanolu. Stanice se zatim ponovo suspendiraju u 0, 5% Triton-X-100/2 N HCl (za detekciju CPD) ili 0, 5% Triton-X-100 / 0, 2 N HCl (za 6-4PP detekciju) 10 min na sobnoj temperaturi. Nakon ispiranja s Tris-bazom 1M (pH 10), a zatim s PBS-om, fibroblasti su se inkubirali preko noći na 4 ° C sa 100 ml PBS-TF (4% FBS / 0, 25% Tween-20 / PBS) koji je sadržavao razrjeđenje 1: 100. bilo protiv anti-6-4PP (Kamiya Biomedical Company, Seattle, WA, SAD) ili anti-CPD (Kamiya Biomedical Company) protutijela. Nakon dvaput ispiranja s PBS-om, stanice se ponovo suspendiraju u 100 ml PBS-TF koji sadrži Alexa-Fluor 488-spojeno sekundarno antitijelo (1: 200) 1 sat na sobnoj temperaturi. Kinetika popravljanja praćena je protočnom citometrijom (FACSalibur, Becton Dickinson, San Jose, Kalifornija, SAD) kako bi se utvrdila promjena geometrijske srednje fluorescencije tijekom vremena. Nepareni Studentov t test koji uspoređuje vrijednost između kontrole i pacijenta u svakom trenutku korišten je u četiri neovisna ispitivanja.

Analiza apoptoze

Procjena UVB-inducirane apoptoze i nekroze izvedena je kao što je prethodno opisano. 9 Ukratko, 16 sati nakon ozračivanja, fibroblasti su se inkubirali 30 min na 37 ° C u mraku s 5 µmol / l FITC-VAD-FMK (Promega, Charbonnières, Francuska) i zatim s 2, 5 µg / ml propidijum-jodida (PI, Sigma, Saint Quentin Fallavier, Francuska). Stanice su odmah analizirane protočnom citometrijom.

Za procjenu aktivacije kaspaze-3/7 korišten je test Caspase-Glo -3/7 (Promega Corp., Charbonnières, Francuska). Ispitivanje daje blistavu kaspazu-3/7 koja se cijepa na aminoluciferin. Oslobođeni aminoluciferin je supstrat koji luciferaza troši, stvarajući luminescentni signal. Signal je proporcionalan aktivnosti kaspaze-3/7. Nakon 16-satnog ultraljubičastog zračenja, fibroblasti su se inkubirali 30 minuta na 37 ° C u mraku s proluminescentnom supstranom kaspaza-3/7, a zatim je luminiscentni signal izmjeren luminometrom GloMax (Promega).

statistika

Sve vrijednosti su srednja ± SEM. Statistički podaci provedeni su pomoću GraphPad Prism 5 softvera primjenom neparnog Studentova t testa za usporedbu dviju neovisnih skupina ili parova za uzastopna mjerenja. Za usporedbu različitih skupina izvedene su jednosmjerne i dvosmjerne ANOVA.

Rezultati

Pacijent

Pacijent je novorođeni muškarac koji je bio četvrto dijete zdravih prvoklasnih mavritanskih roditelja. U obiteljskoj anamnezi majka je u 28 tjedana gestacije imala spontani pobačaj iz nepoznatih razloga. Troje starije djece bilo je zdravo. Obiteljska povijest otkrila je da su jedan brat i jedna sestra od majke umrli u ranoj dobi od albinizma povezanog s nepoznatim poremećajem. U slučaju pacijenta, antenatalni ultrazvučni pregled pokazao je povećanje pericerebellarnog prostora. Roditelji su odbili daljnja prenatalna ispitivanja kao što su MRI fetusa ili amniocenteza. Pacijent je rođen na dan nakon neobičnog porođaja s težinom, visinom i opsegom glave u standardnim rasponima. Predstavljao je homogenu depigmentaciju dlaka i kože, što je povod za okulokutani albinizam (slika 1a). Oftalmološki pregled pokazao je umjerenu hipopigmentaciju mrežnice (nije prikazana). U 4 mjeseca imao je kašnjenje rasta povezano s poteškoćama u hranjenju. Ehokardiografija je otkrila dilataciju lijevog srca, veliki patentni duktus arteriosus i plućnu hipertenziju. Neurološki pregled pokazao je aksijalnu hipotoniju, perifernu hipertoniju povezanu s ekstrapiramidnim simptomima i nekoordinirano kretanje. MRI mozga potvrdio je povećanje pericerebellarnih prostora kompatibilnih s dijagnozom megacisterna magna (slike 1b i c), povezano s bilateralnom perisilvijskom polimikrokerijom (slike 1c i e) i hipoplastičnim corpus callosumom. U 14 mjeseci poteškoće s hranjenjem dovele su do gastrostoma. Ponavljane plućne infekcije zahtijevale su hospitalizaciju na intenzivnoj njezi. Pacijent je umro u dobi od 2 godine nakon plućne dekompenzacije. Hromosomska analiza i mikrorastač širom gena (Agilent, 60 K) nisu otkrili nikakvu anomaliju (46XY). Predložena je dijagnoza okulokutanog albinizma povezanog s nepoznatim povezanim poremećajem.

Image

Pacijentov fenotip. ( a ) Hipopigmentacija s plavom kosom i svijetlom kožom. ( b - e ) MRI presjeci; ( b ) aksijalni T2; ( c ) T2 koronal; ( d ) T1 sagittal; ( e ) aksijalna T2) koja pokazuje povećanje pericerebellarnih prostora (vjerojatno mega cisterna magna; isprekidana plava strelica), nepravilan spoj bijele tvari i sive tvari i abnormalnost giracije s polimikrobiorijom (crvene strelice) i hipoplaziju moždane žlijezde (plava strelica),

Slika pune veličine

Genetske studije

Budući da je pacijentov kompleksni fenotip sugerirao postojanje srodnog sindroma gena, izvršeno je pretraživanje za brisanje koje uključuje jedan od OCA gena i okolnih regija. U tu svrhu upotrijebili smo komparativnu nizu genske hibridizacije (CGH) visoke rezolucije koja pokriva OCA1-4 gene i susjedne genomske segmente s prosječnim razmakom između sondi od 100 bp. 1 Identificirali smo homozigotno brisanje od 286 kb koje se proteže između koordinata chr15: 28143765 i chr15: 28429460 (Hg19) (chr15: g. 28143765_28429460 del) (slika 2a). PCR-amplificirali smo koristeći primere smještene u intronu 56 HERC2 i intronu 19 od OCA2 , fragment 581 bp koji obuhvaća točke prekida brisanja (Slika 2b (i i ii)). Naši podaci pokazali su da je brisanje spojilo egzone 1–56 HERC2 na egzone 20–25 OCA2 . Ovo sugerira da brisanje OCA2 predstavlja albino fenotip kao što je prethodno opisano i da se dodatne teške kliničke manifestacije mogu objasniti brisanjem HERC2 .

Image

Karakterizacija preuređenja DNK. ( a ) Array-CGH analiza homozigotne delecije 285 kb HERC2-OCA2 . Koordinate i Log2 vrijednosti bolesničkog i kontrolnog omjera fluorescencije su označene s lijeve strane i iznad crteža. OCA2 i HERC2 geni su skicirani na lijevoj strani. Prikazani su samo ključni egzoni, predstavljeni brojevima. Točkaste plave linije označavaju prijelomne točke brisanja. ( b ) Redoslijed brisanja spojnice HERC2-OCA2 . (i) Pojačanje fragmenta 541 bp koji sadrži spoj HERC2-OCA2 (P: pacijent; C: kontrolna jedinka koja ne nosi brisanje HERC2-OCA2 ; m: oznaka veličine). Elektroforeza prikazuje niz koji uključuje spoj HERC2-OCA2 . Citozin na mjestu spajanja je označen (plava okomita pruga). (ii) Gornji dio: nizovi koji okružuju prijelomnu vrijednost brisanja telomerne ( HERC2 ) i centromerne ( OCA2 ). Plavo: jedinstveni niz HERC2 . U zelenom 42 bp ponovite uobičajeno za HERC2 i OCA2 . C između zagrada odgovara citozinu označenom u (a). Crvenom bojom: jedinstveni nizovi OCA2 . Prugasti nukleotidi odgovaraju izbrisanim sekvencama. Donji dio: slijed spajanja HERC2-OCA2 kod pacijenta. Kodovi boja su isti kao u gornjem dijelu. Koordinate su u skladu s referentnim redoslijedom iz veljače 2009. (NCBI Build 37.1 / hg19).

Slika pune veličine

Identifikacija transkripcije fuzije HERC2-OCA2 i odsutnost HERC2 proteina u stanicama pacijenta

Uspjeli smo pojačati fragment (OCA2-23) koji obuhvaća egsone 23-24 OCA2 iz RNA pacijentskih fibroblasta, sugerirajući tako da je 3 'kraj OCA2 mRNA izražen kao dio fuzije HERC2-OCA2 transkripta pod kontrolom promotora HERC2 . Da bismo dalje potvrdili da je fuzijski transkript proizveden u pacijentovim stanicama, pojačali smo fragment 515 bp koji obuhvaća HERC2 ekson 56 i OCA2 ekson 20 (fragment zvan HERC2-OCA2). Redoslijed ovog RT-PCR fragmenta pokazao je da se fuzija dogodila na očekivanom položaju u transkriptu. Svi ovi podaci pokazali su da je u fibroblastima pacijenta stvoren fuzijski transkript koji sadrži eksone 1–56 HERC2, a zatim egzone 20–25 OCA2 .

U silikonskom prijevodu ovog fuzijskog transkripta (softver na //insilico.ehu.es/translate/) predvidjeli su proizvodnju skraćenog proteina koji sadrži prvih 2941 aminokiselina HERC2, a zatim 7 aminokiselina izvedenih iz OCA2 sekvence (izvan okvira ) dok se ne dogodi STOP kodon (Podaci nisu prikazani). Predviđenom fuzionom proteinu nedostajalo je domena nalik RCC1 (RLD2, RLD3) (Regulator hromosomske kondenzacije = RCC1) i C-terminalni homologan domenama E6-AP Carboxyl Terminus (HECT) (Slika 3a). Analizom western blota primjenom specifičnog anti-HERC2 antitijela čiji je epitop lagao unutar predviđenog fuzijskog proteina HERC2-OCA2, uočili smo odsutnost proteina HERC2 u pacijentovim fibroblastima u usporedbi s kontrolom, obje u divljoj HERC2 očekivanoj veličini ( Slika 3b) i to kod predviđenog skraćenog proteina. Ovo sugeriše da se skraćeni protein razgrađuje.

Image

Gubitak funkcije HERC2 uzrokuje nakupljanje ubikvitinskih agregata. ( a ) Shematski prikaz proteina HERC2 (gornji) i HERC2-OCA2 predviđeni fuzijski protein (donji). Predviđenom fuzijskom proteinu nedostaju 2 RCC1 domena (regulator kromosomske kondenzacije) domena i funkcionalna C-terminalna HECT domena (Homologna E6-AP karboksilnom terminusu). ( b ) Analiza zapadne mrlje na pacijentovim fibroblastima primjenom anti-HERC2 antitijela čiji epitop leži unutar predviđenog fuzijskog proteina HERC2-OCA2 (prosjek ± SD od 3 neovisna eksperimenta). P, strpljiv; C, kontrola. Očekivane veličine divljeg HERC2 divljeg tipa i predviđeni fuzijski protein HERC2-OCA2 su 527 kDa, odnosno 327 kDa ( c ) Kontrolne (C) i bolesničke (P) stanice su inkubirane s anti-HERC2 (zelenim) i anti-Ubikvitin (crvenim) antitijelima, Nuklei su obojeni DAPI (plavi). Prikazana je reprezentativna stanica za pacijenta i kontrolu. Unutaruklearni žarišta ubikvitina otkrivena su u pacijentovim stanicama (vidi crvene mrlje u uvećanom prikazu jezgre na desnoj strani), u usporedbi s kontrolom. ( d ) Kvantifikacija broja agregata ubikvitina po ćeliji u bolesnika u odnosu na kontrolu (prosjek ± SD od 50 stanica; P <0, 001).

Slika pune veličine

Gubitak funkcije HERC2 dovodi do ubikvitacijskih anomalija i nakupljanja njegovih supstrata

HERC2 je E3-ubikvitin ligaza uključena u ubikvitinaciju nekoliko supstrata. 3, 5, 10 Ubikvitacija je proučavana u fibroblastima pacijenta imunocitohemijom koristeći specifično antitijelo protiv Ubi-Lys48. Uočili smo povećani broj agregata ubikvitina u pacijentovim stanicama u usporedbi s kontrolama. 100% pacijentovih stanica sadržavalo je agregate, s prosječnim brojem 46 agregata po ćeliji (SD = 9, 8). Suprotno tome, samo 40% kontrolnih stanica sadržavalo je agregate, sa prosječnim brojem 5 agregata po ćeliji (SD = 6, 9), razlika koja je bila statistički značajna ( P <0, 001; Slike 3c i d).

Pokazano je da HERC2 cilja degradaciju BRCA1 i XPA. 3, 5 Očekivalo se da je gubitak aktivnosti E3 ubikvitin ligaze HERC2 uzrokovao nakupljanje ovih proteina. U pacijentovim stanicama uočili smo naslage BRCA1 u citosolu (dopunska slika 1). Primijećeno je umjereno nakupljanje XPA zapadnim upijanjem u pacijentovim stanicama u usporedbi s kontrolom ( P <0, 01; Dopunska slika 1).

Akumulacija HERC2 supstrata uključenih u popravak DNA

Dalje smo istražili je li nakupina XPA faktora popravke utjecala na odgovor pacijentovih fibroblasta na ultraljubičasto zračenje. U tu svrhu, fibroblasti su zračeni UVB-om i apoptoza je izmjerena 16 sati nakon ozračivanja protočnom citometrijom upotrebom benziloksikarbonil-valin-alanin-asparaginske kiseline-fluorometil ketona (VAD-FMK), koji se veže na aktivirane kaspaze, i propidijum-jodid (PI), kao pokazatelj propustljivosti membrana plazme. Postoci apoptotičke (VAD-FMK + / PI - ) i kasne apoptotske plus nekrotičke stanice (VAD-FMK + / PI + ) pokazali su da je pacijentove stanice zabilježile 47% smanjenje osjetljivosti na UVB-induciranu apoptozu u usporedbi s kontrolnim stanicama (Slika 4). Prema tome, mjerenje aktivacije kaspaze izazvane ultraljubičastim B-om otkrilo je jasno smanjenje aktivacije kaspaze3 / 7 u fibroblastima pacijenta u usporedbi s kontrolama (Slika 4).

Image

Akumulacija HERC2 supstrata uključenih u popravak DNA. ( a ) Analiza apoptotskih i kasnih apoptotskih / nekrotičnih stanica i aktivnosti kaspaze-3 nakon UVB zračenja. ( b ) Analiza kinetike popravljanja 6-4PP (6-4 fotoproizvoda) i CPD (ciklobutanski pirimidinski dimeri) nakon UVB zračenja. Manja osjetljivost na apoptozu uočena je u stanicama pacijenta s sporijom relativnom aktivnošću kaspaze i povećanom stopom uklanjanja CDP fotolezija. Nije uočena razlika nakon uklanjanja 6, 4PP. Rezultati su izraženi kao srednja vrijednost ± SD za 4 neovisna pokusa.

Slika pune veličine

Da bismo dalje istražili posljedice nakupljanja faktora XPA popravljanja nukleotidne ekscizije (NER), procijenili smo kinetiku popravljanja 6-4 fotoprodukta (6-4PPs) i ciklobutanskih pirimidinskih dimera (CPD), koji su najčešći tipovi uklonjenih fotolezija prvenstveno od NER-a s različitom kinetikom. 11 , 16 Nakon izloženosti UVB-u došlo je do brzog pada 6-4PP-a što je rezultiralo 70 ± 7% i 72 ± 8% uklanjanja 6-4PPs 2, 5 h nakon ozračivanja u kontrolnoj skupini i fibroblasta pacijenta (Slika 4b). Postepeno popravljanje 6-4PP u narednim satima dovelo je do 93 ± 5% i 94 ± 6% uklanjanja do 20 h u kontrolnoj i pacijentovoj fibroblasti, respektivno (Slika 4b). Kinetika popravka CPD-a u ozračenim kontrolnim fibroblastima otkrila je da se CPD-i postupno uklanjaju nakon UVB zračenja, to jest uklanjanje 12 ± 6% u 0, 5 h nakon ozračivanja, dostižući polako 53 ± 6% i 64 ± 5% u 10 sati i 20 sati nakon zračenja, odnosno Slika 4b). U bolesnikovim fibroblastima, neposredno uklanjanje CPD-a bilo je približno isto (8% ± 7 do 0, 5 h) kao u kontrolnim ćelijama, dok je stopa kasne popravke CPD-a bila veća nego u kontroli, jer je 70 ± 6% i 80 ± 6% CPD-a uklonjeni su 10 sati i 20 sati nakon ozračivanja (Slika 4b). Razlike između dvije skupine značajne su u 5, 10 i 20 sati nakon ozračivanja s p vrijednostima 0, 017, 0, 0067 i 0, 0058. U prethodnom istraživanju je također pokazano da pad HERC2 pomoću siRNA povećava razinu XPA u stalnom stanju i brzinu popravljanja oba ultraljubičastog fotoprodukta. 3

Sve u svemu, ovi rezultati ukazuju da je popravak CPD-a veći u stanicama pacijenta u usporedbi s kontrolama, dok nije uočena značajna razlika koja se odnosi na popravljanje 6-4PP. Ove anomalije vjerojatno su nastale zbog gubitka funkcije, a ne zbog OCA2, a ne zbog OCA2.

Rasprava

Identificirali smo homozigotnu deleciju od 286 kb koja obuhvaća egzone 57 do 93 gena HERC2 i eksone 1 do 19 OCA2 gena kod pacijenta koji ima OCA i teške neurološke anomalije.

HERC2 protein pripada obitelji HERC proteina i dijeli s HERC1 njegovu veliku veličinu, RLD-1 domenu na N-terminusu, te RLD i HECT domene na C-terminusu. 12 Donedavno HERC2 ljudski gen nije bio uzročno povezan s bilo kojom ljudskom bolešću.

Za miševe Rjs prijavljeno je da imaju neuromuskularne i spermatogene poremećaje, a karakterizirane su oštećenjima u rastu, koordinaciji pokreta (trnovit hod) i plodnosti. Jedan od rjs mutanta izrazio je skraćeni protein HERC2 kojem nedostaje dio C-terminalne HECT domene. 13 Ovo ukazuje da gubitak aktivnosti HERC2 E3 može biti odgovoran za promatrani fenotip u miševa. Varijanta zablude (c.1781C> T, str (Pro594Leu)) gena HERC2 nedavno je povezana s anđeoskim poremećajem kod sedam pacijenata iz zajednice starog Amiša. 6, 7 Fenotip primijećen u ovih bolesnika uključivao je hipotoniju novorođenčadi, globalno kašnjenje u razvoju i nestabilnost hodanja. Ispitivanja kranijalne magnetske rezonancije bila su normalna za jednog pacijenta i pokazala su blagu cerebralnu atrofiju kod jednog dodatnog. 7 Kliničke prezentacije sedmero bolesnika bile su manje ozbiljne nego kod našeg pacijenta, vjerojatno zato što je mutirani protein HERC2 sačuvao dio njegove aktivnosti. Homozigotna deletacija utvrđena kod našeg pacijenta rezultira potpunom odsutnošću HERC2 proteina što vjerojatno objašnjava ozbiljnost razvojnih poremećaja.

Zanimljivo je da je homozigotna mutacija gluposti (c.9748C> T, str (R3250 *)) u drugom HERC-ovom genu, HERC1, nedavno prijavljena kod pacijenta rođenog od roditelja rodbine i s teškim intelektualnim onesposobljenjem, megalenfalijom, gustim tjelesnim kalusom i mali mozak. 14

Anomalije sekundarne HERC2 gubitku funkcije mogu uključivati ​​HERC2 supstrate kao što su XPA i BRCA1, proteine ​​koji su sveprisutni s HERC2. 3, 5 Primijetili smo da nedostatak aktivnosti ubikvitin ligaze HERC2 E3 povećava obilje XPA i BRCA1. Povećana razina XPA i BRCA1 može utjecati na popravak DNK, uključujući DNK dvostruke niti (DDS) i nukleotidne popravke preciznosti (NER). Doista smo primijetili povećanu popravku DNA fotolezijama CPD-a i smanjenu osjetljivost na apoptozu i kaspaznu aktivnost nakon UVB zračenja u pacijentovim stanicama. Kako je popravak DNA strogo reguliran proces, povećana popravka DNK i smanjena osjetljivost na apoptozu mogu imati posljedice na normalan embrionalni ili fetalni razvoj, te stoga mogu sudjelovati u fenotipu koji je opažen kod našeg pacijenta. 15 Predložena je ispravna popravka DNK za održavanje funkcionalnog integriteta živčanog sustava sprečavanjem prerane smrti neurona. 11 Potrebne su daljnje studije za objašnjenje patofiziološke veze između tih fenomena.

HERC2 i UBE3A / E6AP, čiji gubitak funkcije uzrokuje Angelmanov sindrom, su ubikvitinske ligaze. HERC2 stimulira aktivnost ubikvitin-ligaze UBE3A / E6AP kroz RLD2 domenu. 4 Očekuje se da će oštećenje aktivnosti ligaze UBE3A / E6AP E3 zbog oštećenja HERC2 rezultirati smanjenom sveprisutnošću i degradacijom UBE3A / E6AP supstrata. Utjecaj HERC2 na UBE3A / E6AP i ostale specifične supstrate može pridonijeti ozbiljnosti bolesti opažene kod ovdje opisanog pacijenta. 10

Opis našeg pacijenta s teškim neurorazvojnim abnormalnostima koji ima potpuni gubitak funkcije HERC2 sugerira da je duboka disfunkcija povezana s ubikvitin ligazom odgovorna za abnormalni razvoj mozga. Brisanje HERC2 moglo bi biti povezano s težim fenotipom od mutacije zablude koja je prethodno povezana s autističnim globalnim kašnjenjem u razvoju i poremećajem spektra autizma. 6, 7 Ovo izvješće proširuje spektar bolesti povezanih s HERC2. Potrebne su daljnje studije kako bi se razumjela veza između nedostataka ubikvitacije i neurorazvojnih abnormalnosti.

Dodatna informacija

Datoteke slika

  1. 1.

    Dopunska slika 1

    Dodatne informacije nalaze se u ovom radu na web stranici Europskog časopisa za humanu genetiku (//www.nature.com/ejhg)