Csr sustav regulira stabilnost i transkripciju mrna na cijelom genomu i tako ekspresiju gena u escherichia coli | znanstvena izvješća

Csr sustav regulira stabilnost i transkripciju mrna na cijelom genomu i tako ekspresiju gena u escherichia coli | znanstvena izvješća

Anonim

teme

  • Fiziologija bakterija
  • Biologija bakterijskih sustava

Sažetak

Za prilagođavanje bakterija potrebna je velika regulacija ekspresije gena. Proveli smo analizu Csr sustava na razini genoma koja regulira mnoge važne stanične funkcije. Csr sustav uključen je u regulaciju transkripcije, ali je također predložena uloga u regulaciji transkripcije. Dva proteina, Rs-vezani protein CsrA i atipični signalni protein CsrD, sudjeluju u Csr sustavu. Stabilnost i razine transkripta na cijelom genomu uspoređeni su u divljom tipu E. coli (MG1655) i izogenim mutantnim sojevima koji su manjkali CsrA ili CsrD aktivnost pokazujući prvi put da su CsrA i CsrD globalni negativni i pozitivni regulatori transkripcije. Uloga CsrA u regulaciji transkripcije može biti neizravna zbog povećavanja koncentracije csrD mRNA u 4, 6 puta u soju deficitarnog CsrA. Transkripcijsko djelovanje CsrA i CsrD na nekoliko gena potvrđeno je transkripcijskim fuzijama. Uz učinak na transkripciju, CsrA stabilizira tisuće mRNA. Ovo je prva demonstracija da je CsrA globalni pozitivni regulator stabilnosti mRNA. Za stotinu gena predviđamo da izravna kontrola stabilnosti mRNA pomoću CsrA može doprinijeti metaboličkoj adaptaciji reguliranjem ekspresije gena uključenih u metabolizam ugljika i transporta neovisno o regulaciji transkripcije.

Uvod

Organizmi su razvili više mehanizama regulacije ekspresije gena kako bi prilagodili svoju fiziologiju i metabolizam promjenjivom okolišu kako bi se mogli natjecati s drugim vrstama. U bilo kojem trenutku procesa prilagodbe, unutarćelijska razina mRNA izravni je rezultat regulacije ekspresije gena. Za svaki gen, ravnoteža dvaju neovisnih staničnih procesa, sinteza i razgradnja mRNA određuje količinu mRNA. Prethodno je pokazano da su ove dvije razine pridonijele procesima prilagodbe kod različitih organizama 1, 2, 3, 4 .

Na razini genoma, globalni regulatori omogućuju koordiniranu kontrolu ekspresije velikog skupa gena nakon osjetljivih promjena u okolišu. Većina poznatih globalnih regulatora u bakterijama su transkripcijski regulatori (CRP, Fis, itd.)

,

) s dobro opisanim mehanizmima djelovanja. Oni aktiviraju ili suzbijaju pokretanje transkripcije mRNA pomoću RNA polimeraze i kontroliraju globalni metabolizam poput unosa ugljika i disanja 5, 6 . Samo nekoliko globalnih regulatora djeluje na post-transkripcijskoj razini na stabilnost mRNA. Jedan primjer je protein Rf koji veže Hfq, homolog Sm i Lsm proteina koji čine jezgru kompleksa za razmnožavanje i razgradnju mRNA u eukariotima. Hfq olakšava interakcije u baznom uparivanju regulatornih nekodirajućih malih RNA (sRNA) na više ciljnih mRNA 7 kako bi se destabilizirala mRNA i regulirala ključna metabolička metabolička staza 8, 9 .

Sustav Csr / Rsm (regulator skladištenja ugljika / represor sekundarnih metabolita) je višekomponentni globalni regulatorni sustav, dobro očuvan u bakterijama, koji kontrolira gensku ekspresiju mnogih važnih staničnih funkcija. Csr sustav potiskuje metabolizam glikogena, glukoneogenezu, stvaranje biofilma i osjet kvoruma, dok aktivira glikolizu, staničnu pokretljivost, virulenciju i patogenezu kao što je pokazano u γ-proteobakterijama poput Escherichia, Salmonella, Erwinia, Pseudomonas ili Vibrio 10 . Sastoji se od dva proteina, CsrA, proteina koji veže RNA, i CsrD, pretpostavljenog signalnog proteina, i dva regulatorna sRNA, CsrB i CsrC11. Csr sustav je uglavnom poznat po svojoj post-transkripcijskoj ulozi u stabilnosti mRNA. U E. coli K-12 sojevima dokazano je da mRNA vezanje CsrA destabilizira četiri transkripta ( glgCAP, pgaABCD, ydeH i ycdT ) 12, 13, 14, 15 i da stabilizira jedan ( flhDC ) 16 . CsrD protein potiče razgradnju CsrB i CsrC17. Originalnost Csr sustava je kombiniranje regulacije na više razina koja djeluje na post-translacijskoj razini, ali i na razini transkripcije. Osim svoje uloge u stabilnosti mRNA, Csr sustav je doista uključen u post-translacijsku regulaciju aktivacijom enzimske aktivnosti18 ovisnom o CsrA. Aktivnost CsrA sama je regulirana sekvestracijom sRNA CsrB, CsrC i McaS 19, 20, 21, 22. Na razini transkripcije, CsrA djeluje s globalnim strogim odgovorom 23 i dvokomponentnim sustavom transdukcije signala BarA / UvrY 24, 25, dva glavna aktera u regulaciji ekspresije gena E. coli . Uloga CsrD-a na razini transkripcije još nije u potpunosti shvaćena. Iako CsrD sadrži GGDEF / EAL domene, CsrD nije izravno uključen u c-di-GMP metabolizam 17, 26 . Međutim, pokazano je da CsrD regulira ekspresiju transkripcijskog regulatora CsgD mehanizmima koji još nisu u potpunosti razjašnjeni 26 .

Kako Csr sustav kombinira transkripcijsku i post-transkripcijsku regulaciju na razini genoma za kontrolu glavnih fizioloških funkcija još nije utvrđeno. Postoji ograničen broj genskih studija Csr sustava, a sve su bile usredotočene na CsrA. Popisi CsrA ciljanih gena dobiveni su analizom interakcije mRNA i proteina 23, alatima za bioinformatiku 27, 28 i transkriptomskom analizom 15 . Kad su promjene u količinama mRNA utvrđene transkriptomskom analizom kao odgovor na pretjeranu ekspresiju csrA 15, mjerenje stabilnosti mRNA nije istodobno izvedeno s ciljem ometanja propisa o transkripciji i post-transkripciji.

Ovdje smo razjasnili mreže regulacije CsrA i CsrD, kako na razini transkripcije, tako i na post-transkripciji. Utvrdili smo i usporedili podatke o genomu o količini mRNA i stabilnosti mRNA u soju MG1655 divljeg tipa, u soju koji sadrži djelomičnu deleciju csrA , MG1655 ( csrA51 ) i u soju izbrisanom od csrD , MG1655 (Δ csrD ). Korištenjem integrativnog pristupa, pokazujemo da su i u našem eksperimentalnom stanju CsrA i CsrD uključeni u masivnu transkripcijsku regulaciju, dok regulacija stabilnosti mRNA u cijelom genomu ovisi samo o CsrA. Razgovaramo o ovim rezultatima u smislu izravnih i neizravnih učinaka i pokazujemo kako izravna kontrola stabilnosti mRNA pomoću CsrA doprinosi metaboličkoj prilagodbi.

Rezultati

Izgradnja i rast mutantnih sojeva MG1655 ( csrA51 ) i MG1655 (Δ csrD )

CsrA gen je važan za staničnu vitalnost u E. coli K-12 sojevima uzgojenih na glikolitičkim izvorima 29, 30 . Hipomorfni mutant koji odgovara umetanju transposona u gen csrA održiv je i korišten je u brojnim istraživanjima uloge CsrA 31, 32, 33, 34 . CsrA je dimerni protein RNA koji veže 35 aminokiselina 35 . Umetanje transpozona rezultira proizvodnjom 50 aminokiselinskih proteina izbrisanih iz C-terminalne domene dimerizacije 36 . Da bismo stvorili izogene sojeve u pozadini MG1655, konstruirali smo MG1655 ( csrA51 ) soj umetanjem zaustavnog kodona u položaj 51. U ovom konstruktu sačuvan je signal za zaustavljanje endogene transkripcije nizvodno od zaustavnog kodona. Kao što se očekivalo 36, soj MG1655 ( csrA51 ) proizveo je mnogo više glikogena nego soj MG1655 i taj se fenotip ukida dopunjavanjem ektopične kopije divljih vrsta csrA (dopunska slika Sl. S1). Mutirani soj je također pokazao značajno manju pokretljivost i više stvaranja biofilma (dopunski Sl. Sl.), Kao što se očekivalo 14, 16 . Mjerenje nivoa CsrB i CsrC sjevernog ugljika u soju MG1655 ( csrA51 ) pokazalo je odsutnost ekspresije dviju sRNA (dopunski Sl. S1), potvrđujući ulogu CsrA u transkripcijskoj aktivaciji CsrB i CsrC 24 . Svi ovi rezultati potvrdili su da se aktivnost C-terminala skraćene varijante CsrA drastično smanjila u našem soju MG1655 ( csrA51 ) 10 .

Soj MG1655 (Δ csrD ) konstruiran je potpunom delecijom gena csrD u E. coli MG1655. Kad su uzgajane u šarži u minimalnom mediju M9 dopunjenom glukozom, stanice MG1655 ( csrA51 ) pokazale su dvostruko smanjenu maksimalnu stopu rasta (μ max = 0, 31 ± 0, 01 h -1 ) u usporedbi s divljim tipom (μ max = 0, 63 ± 0, 01 h - 1 ) (Sl. 1); normalan rast obnovljen je nadopunjavanjem ektopičnom kopijom gena divljeg tipa csrA (Sl. 1). Suprotno tome, na maksimalnu brzinu rasta blago je utjecao MG1655 (Δ csrD ) (0, 52 ± 0, 08 h -1 ) u usporedbi s sojem MG1655 (Sl. 1). Da bi se uklonili učinci brzine rasta na poluživot mRNA i razine 3 i omogućila usporedba između sojeva, sojevi MG1655, MG1655 ( csrA51 ) i MG1655 (Δ csrD ) uzgajani su u kontinuiranoj kulturi uz ekvivalentnu stopu rasta od 0, 10 h -1, Mutacije csrA51 ili Δ csrD nisu utjecale na ponašanje makrokinetike sojeva (Tablica 1). Ukupna potrošnja glukoze (3 g / l) i nije proizveden acetat. Nešto veći prinos biomase izmjeren je u soju MG1655 ( csrA51 ). Mutacija csrA51 povezana je s 5 puta većim sadržajem unutarćelijskog glikogena u odnosu na soj MG1655 (Tablica 1).

Image

Slika pune veličine

Tablica pune veličine

Učinak mutacija csrA51 i r csrD na stabilnost mRNA

Pokazano je da CsrA regulira stabilnost nekoliko mRNA 11 . Međutim, mnogo je više mogućih ciljeva sugerisano interakcijskom studijom 23 i analizom bioinformatike 27, 28 . CsrD je uključen u preusmjeravanje dva sRNA CsrB i CsrC 17, ali njegovo sudjelovanje u regulaciji stabilnosti mRNA još nije istraženo. Da bismo istražili uključenost CsrA i CsrD u regulaciju stabilnosti mRNA, uspoređivali smo mjerenja stabilnosti mRNA na cijelom genomu u sojevima MG1655, MG1655 ( csrA51 ) i MG1655 (Δ csrD ), uzgojenim u kontinuiranoj kulturi u 0, 1 h -1 (Dodatna tablica S1). Transkripti su globalno manje stabilni u MG1655 ( csrA51 ) nego u soju MG1655, srednji poluživot se smanjio sa 4, 5 min u MG1655 na 2, 9 min u mutantnom soju (Sl. 2a). Preciznije, statistički test (P-vrijednost ≤ 0, 1) identificirao je 1672 glasnika s različitim polu-životom između sojeva MG1655 ( csrA51 ) i MG1655: 1618 je značajno destabiliziran u mutantnom soju, dok je 54 značajno stabilizirano (Sl. 2b). Zanimljivo, ovi rezultati pokazuju sudjelovanje CsrA u regulaciji stabilnosti mRNA na cijelom genomu, a posebno masivnu destabilizaciju mRNA u mutantnom soju MG1655 ( csrA51 ).

Image

( a ) Okvirne ploče transkripta poluživota za sojeve MG1655, MG1655 ( csrA51 ) i MG1655 (( csrD ) (n = 3351 mRNA). Vrijednosti su razdvojene u četiri četvrtine vodoravnim šipkama. Središnja traka (u sredini pravokutnika) predstavlja srednju vrijednost koja je dana iznad šipke. VolcanoPlot promjene log 2 puta (Log 2 FC) razdoblja poluživota mRNA ( b ) između sojeva MG1655 ( csrA51 ) i MG1655 (n = 3028 mRNA) i ( c ) između sojeva MG1655 (Δ csrD ) i MG1655 ( n = 3333 mRNA). P značajka ≤ 0, 1 bila je potrebna za značaj promjene promjene savijanja (iznad vodoravne isprekidane linije). Značajno stabilizirane mRNA u mutiranom soju u usporedbi s sojem MG1655 obojene su crvenom bojom, dok su značajno destabilizirane mRNA obojene zelenom bojom.

Slika pune veličine

Srednji poluživot mRNA u MG1655 (Δ csrD ) bio je samo neznatno viši nego u soju MG1655 (Sl. 2a). Međutim, primjenom istog statističkog testa korištenog za soj MG1655 ( csrA51 ) (P-vrijednost ≤ 0, 1), nije pronađena mRNA sa značajnom varijacijom stabilnosti između sojeva MG1655 (Δ csrD ) i MG1655 (slika 2c) koji sugeriraju mali sustavni porast globalne stabilnosti mRNA. Ovo je opažanje prilično iznenađujuće budući da se prema uspostavljenoj regulatornoj mreži Csr sustava vjeruje da CsrD pozitivno regulira aktivnost CsrA putem destabilizacije CsrB i CsrC 17 . Slijedom toga, očekivala se destabilizacija kao što je već uočeno za soj MG1655 ( csrA51 ) u soju MG1655 ( c csrD ). Da bismo bolje razumjeli ovaj fenotip, mjerili smo polovičnim poluraspadima i razinama sjevernog ugljika CsrB i CsrC. Kao što je prethodno prikazano 17, CsrB i CsrC sRNA snažno su stabilizirani u soju MG1655 ( csrD ) (dopunski Sl. S2), ali njihove razine nisu odgovarajuće modificirane, što sugerira transkripcijsku retrokontrolu: doista je razina CsrB povećana samo oko dvije u našem eksperimentalnom stanju, dok je razina CsrC čak smanjena oko dva puta (Sl. 3). Budući da regulacija CsrD prometa CsrB i CsrC ovisi o fiziološkom statusu stanica 37, stabilizacija CsrB i CsrC sRNA pokazuje da je CsrD bio aktivan u našem stanju rasta. Očekuje se da će suprotna regulacija razina CsrB i CsrC tek neznatno modificirati količinu CsrA sekvestrirane od strane dvije sRNA u soju MG1655 ( c csrD ) u odnosu na soj MG1655. Stoga bi CsrA trebao pokazati prilično sličnu aktivnost u dva soja. Ovaj zaključak je na fenotipskoj razini potkrijepljen nepostojanjem odgovora glikogena vezanog za CsrA u soju MG1655 (Δ csrD ) u usporedbi s sojem MG1655. Izmjerili smo sadržaj glikogena u soju MG1655 (Δ csrD ) i nismo utvrdili porast sadržaja glikogena (tablica 1). U našim uvjetima rasta, prisutnost / odsutnost CsrD nije utjecala na stabilnost mRNA, niti putem CsrD izravnog ciljanja niti preko aktivnosti CsrA.

Image

( a ) Sjeverne mrlje ukupne RNA sonde za CsrB i CsrC. ( b ) Hibridizacijski signali kvantificirani na PhosphorImager-u. Signali za MG1655 postavljeni su na 100%.

Slika pune veličine

Učinak mutacija csrA51 i c csrD na razine mRNA

Da bismo procijenili transkripcijski utjecaj CsrA i CsrD, prvo smo izmjerili transkriptomski odgovor u mutantnim sojevima MG1655 ( csrA51 ) i MG1655 (Δ csrD ) (Dodatna tablica S2). Nasuprot masivnoj destabilizaciji mRNA u soju MG1655 ( csrA51 ), transkriptomske analize pokazale su globalnu up-regulaciju količine mRNA s 2195 mRNA značajno višom u usporedbi sa 249 mRNA značajno nižim (slika 4a). Izrazite regulirane ekspresije uglavnom su se odnosile na biogenezu stanične stijenke i membrane i na mehanizme transdukcije signala, dok su se dolje regulirani izrazi odnosili na pokretljivost stanica i transport i metabolizam ugljikohidrata (dopunska tablica S3). Ti su rezultati u skladu s našom fenotipskom karakterizacijom i literaturom (manje pokretljivosti, više stvaranja biofilma i nakupljanja glikogena). Skupine „Organizacija flagela“ i „Cilijarski ili flagelarni pokretljivost“ (koji sadrže gensidon gen, fli i flg operons ) obogaćene su u dolje reguliranim razinama mRNA u korelaciji sa smanjenom pokretljivošću 16, 38 . GO pojam “Formiranje biofilma pojedinačnih vrsta” (uključujući csg i ydeH gene) obogaćen je u skupini do reguliranih razina mRNA, ali iddV, yjjC i yliE mRNA koja kodiraju GGDEF / EAL proteine ​​uključene u c-di-GMP metabolizam 15, 33, Svi transkripti uključeni u sintezu glikogena ( glgC, glgB, glgA i glgP / Y ) bili su najmanje 3-puta gore regulirani, u skladu s visokom razinom glikogena proizvedenog u MG1655 ( csrA51 ) u našem eksperimentalnom stanju (Tablica 1). Štoviše, brojne transkripte za čije izraze se zna da kontrolira CsrA, uključujući pck, cstA, hfq, relA i spoT , ponašanje je u skladu s literaturom 23, 36, 39, 40 .

Image

VolcanoPlot promjene log 2 puta (Log 2 FC) mRNA iznosi (n = 4254 mRNA) ( a ) između sojeva MG1655 ( csrA51 ) i MG1655 i ( b ) između sojeva MG1655 (Δ csrD ) i MG1655. P-vrijednost ≤ 0, 01 (iznad vodoravne isprekidane crte) i log 2 FC viši od 0, 5 ili niži od –0, 5 (izvan vertikalnih isprekidanih linija) bili su potrebni za značaj promjene promjene. Između mutantnog i MG1655 soja, značajno regulirane količine obojene su crvenom bojom, dok su značajno niže regulirane razine obojene zelenom bojom.

Slika pune veličine

Primjećen je snažan transkriptomski odgovor u soju MG1655 (Δ csrD ) u odnosu na soj MG1655 (Sl. 4b). Velika većina gena bila je dolje regulirana (3345/4254), a samo je 61 bio znatno gore reguliran. U soju MG1655 ( csrA51 ) očekuje se veza između ekspresije CsrA i CsrD zbog negativne regulacije ekspresije gena csrD CsrA 15, 17 . Naši rezultati pokazuju da je količina mRNA csrD snažno povećana u soju MG1655 ( csrA51 ) (4, 6-puta povećanje). Uzimajući u obzir ovaj rezultat, uspoređivali smo transkriptomske odgovore u sojevima MG1655 ( csrA51 ) i MG1655 ( c csrD ). 77% (1878/2444) različito izraženih mRNA u MG1655 ( csrA51 ) također su različito izraženi u Δ csrD, a za većinu njih (1653/1878) regulacija je bila u suprotnim smjerovima: najveći dio gore reguliranih mRNA u MG1655 ( csrA51 ) bili su regulirani u soju MG1655 ( c csrD ). Svi ovi rezultati pokazuju da mutacije CsrA i CsrD induciraju snažnu ali suprotnu globalnu regulaciju nivoa mRNA te da bi transkriptomski odgovor primijećen u soju MG1655 ( csrA51 ) mogao barem djelomično posredovati CsrD.

CsrA i CsrD uključeni su u veliku regulaciju transkripcije

Za dešifriranje globalnih uloga CsrA i CsrD na transkripcijskoj razini integrirali smo skupove podataka stabilnosti mRNA i količine mRNA izmjerene u sojevima MG1655, MG1655 ( csrA51 ) i MG1655 (Δ csrD ). Razlika u koncentraciji mRNA između svakog mutanta i soja divljeg tipa može biti posljedica promjene u sintezi mRNA (transkripcija), razgradnje i / ili razrjeđivanja mRNA jer stanice dijele ne nužno istom brzinom. U našim eksperimentima, svi sojevi uzgajani su s istom brzinom rasta, pa se učinak razrjeđivanja mRNA na ekspresiju gena može eliminirati. Stoga se sve promjene razine mRNA u našem istraživanju mogu objasniti samo regulacijom transkripcije i / ili stabilnosti mRNA.

U soju MG1655 (Δ csrD ) nije postojala značajna modifikacija pojedinačne stabilnosti transkripta dok je za 3345 gena opažen negativan transkriptomski odgovor. Stoga su ove promjene razine mRNA posljedica uglavnom regulacije transkripcije. Slično tome, u MG1655 ( csrA51 ) su 542 mRNA regulirane na razini mRNA (pozitivno za 82%), ali ne i u stabilnosti. To pokazuje da mutiranje csrA izaziva transkripcijski odgovor, koji je općenito pozitivan. Ovi rezultati pokazuju da CsrD i CsrA reguliraju veliki broj gena djelujući samo na nivou transkripcije. Molekularna validacija široko rasprostranjenog transkripcijskog djelovanja CsrA i CsrD osigurana je transkripcijskim fuzijama koristeći laporZ reporterski gen. Potvrdili smo višu lacZ ekspresiju pod kontrolom glgB i ydeH promotora u soju MG1655 ( csrA51 ) u odnosu na soj MG1655, a donji izraz lacZ pod kontrolom frdA i csrC promotora u MG1655 (Δ csrD ) soj MG1655 (dopunska tablica S4).

Da bismo produbili regulaciju transkripcije, tražili smo promjene u razini gena mRNA koje se odnose na funkcionalnu kategoriju "Transkripcija, ovisna o DNA" u MG1655 (Δ csrD ) i MG1655 ( csrA51 ), u odnosu na soj MG1655. Zanimljivo suprotna regulacija primijećena je u mutiranim sojevima, jer su geni koji kodiraju protein uključen u transkripciju bili dolje regulirani u soju MG1655 ( csrD ), ali gore regulirani u MG1655 ( csrA51 ) (Tablica 2). Ti geni odgovaraju RNA polimerazi (β i β 'podjedinice, rpoB i rpoC ), sigma faktorima ( rpoD, rpoE, rpoH, rpoN, rpoS i fecI ), faktorima uključenim u strogi odgovor ( relA, spoT i dksA ) i globalnoj transkripciji regulatori. Preciznije, transkripcijski regulatori bili su crp, cyaA i fruR / cra za regulaciju protoka ugljika, fnr i arcA koji su uključeni u regulaciju aerobnih / anaerobnih metabolizama i ihfA i ihfB koji kodiraju IHF faktor uključen u kromosomsku strukturu. Uzeto zajedno s gore reguliranom ekspresijom csrD mRNA u soju MG1655 ( csrA51 ), ovi rezultati podržavaju zaključak da regulacija transkripcije posredovana s CsrD doprinosi transkripcijskom odgovoru opaženom u MG1655 ( csrA51 ).

Tablica pune veličine

CsrA je globalni pozitivni regulator stabilnosti mRNA

Kako bismo dešifrirali preciznu ulogu CsrA u velikoj skali regulacije stabilnosti mRNA, razmotrili smo varijacije i stabilnosti mRNA i koncentracije između MG1655 ( csrA51 ) i MG1655. Odstupanja u stabilnosti i razini u MG1655 ( csrA51 ) u usporedbi s MG1655 shematski su podijeljena u tri skupine (sl. 5a i dodatna tablica S5). Grupi I je odgovarala varijacija u količini mRNA koja nije povezana s varijacijom u stabilnosti. Ova skupina je sadržavala gore spomenute 542 mRNA čije su razine bile pod nadzorom transkripcije. U dvije druge skupine, stabilnost i količina razlikovale su se u MG1655 ( csrA51 ) u usporedbi s MG1655. U skupini II (n = 1217), stabilnost i količina varirali su u suprotnom smjeru (niža stabilnost povezana s većom količinom u MG1655 ( csrA51 ) u usporedbi s MG1655 ili obrnuto), dok su u skupinu III (n = 455) bile uključene mRNA koje pokazuju stabilizaciju sa sličnim ili viša razina i destabilizacija sa sličnom ili nižom razinom.

Image

( a ) Varijacije u stabilnosti i količini mRNA između sojeva MG1655 ( csrA51 ) i MG1655. mRNA s promjenom razine, ali ne i stabilnosti u MG1655 ( csrA51 ) u usporedbi s MG1655, nalaze se u skupini I, one s varijacijama u stabilnosti i količini u suprotnim smjerovima su u skupini II, a one s varijacijama stabilnosti i količine koje nisu u suprotnim smjerovima u grupi III. ( b ) Grafikoni poluraspada transkripta (u min) kao funkcija količine transkripta (u proizvoljnim jedinicama po mg težine suhe stanice) u soju MG1655 (n = 3074 mRNA) i MG1655 ( csrA51 ) (n = 4098 mRNA ). Sve vrijednosti su transformisane i centrirane. Pearsonov koeficijent korelacije je -0, 81 s P-vrijednošću <2, 2E -16 .

Slika pune veličine

U prethodnoj studiji pokazali smo u E. coli na skali genoma da je količina mRNA glavna odrednica njegove stabilnosti 41 . Vrijeme poluživota iscrtavanja mRNA kao funkcija njezine količine u MG1655 ( csrA51 ) i MG1655 pokazalo je snažnu negativnu korelaciju (Sl. 5b). To ukazuje da se za određenu mRNA, promjena stabilnosti između MG1655 ( csrA51 ) i MG1655 može potencijalno povezati s promjenom koncentracije. Drugim riječima, stabilizacija mRNA u MG1655 ( csrA51 ) može biti rezultat niže količine mRNA, dok destabilizacija može biti posljedica veće količine. Taj je odnos potvrđen na molekularnoj razini (Nouaille i sur ., Rukopis u pripremi). Stoga je za 1217 transkripata grupe II s antagonističkom regulacijom stabilnosti i količine u MG1655 ( csrA51 ) regulacija stabilnosti mRNA mogla odgovarati izravnom utjecaju CsrA na stabilnost mRNA ili neizravnom učinku zbog promjene razine mRNA ovisno o regulacija transkripcije. Regulacija stabilnosti ovih mRNA od strane CsrA je stoga složena zbog preklapajućih izravnih i neizravnih učinaka. Većina mRNA (1215/1217) destabilizirana je s reguliranom razinom, a funkcionalne klase poput "replikacije DNK" i "transdukcija signala" obogaćene su u ovoj skupini (dopunska tablica S5). Prisutnost konsenzusnog mjesta vezanja CsrA RUACARGGAUGU 27 istraživana je u području −100 / + 100 nt (+1 što odgovara početnom kodonu) od 1217 transkripata. 635 prikazano najmanje jedno pretpostavljeno CsrA mjesto za vezivanje.

Za 455 mRNA grupe III sa stabilnošću i količinom koja varira u istim smjerovima, varijacija poluživota ne može se objasniti promjenom količine u skladu s korelacijom prikazanom na slici 5b. Slijedom toga, vjerovatno je da njihovu stabilnost izravno kontrolira CsrA; te su se mRNA stoga predviđale kao vjerojatni izravni post-transkripcijski ciljevi CsrA. Mnogi su bili novi ciljevi CsrA, budući da su unakrsne usporedbe našeg popisa s prethodnim studijama pokazale da je samo 10 i 93 već u silikonski predviđenom 28 ili je pokazano da istodobno pročišćavaju CsrA 23 (Dodatna tablica S6). Kao i ranije, u 455 transkripta ispitivano je prisustvo mjesta vezivanja CsrA konsenzusa. Otkrili smo da 180 mRNA prikazuje jedinstveno pretpostavljeno CsrA mjesto vezanja, dok 78 ima najmanje 2 mjesta s vrućom lokalizacijom u regiji 5'UTR (Dodatna tablica S6). Uzeto zajedno, predviđeno je da za više od 65% (297/455) eksperimentalno veže CsrA 23 i / ili da postoji pretpostavljeno CsrA mjesto vezanja. Ovi rezultati sugeriraju da će većina identificiranih CsrA izravnih post-transkripcijskih ciljeva vjerojatno fizički utjecati na CsrA protein, iako se lažno pozitivno eksperimentalno vezivanje 23 i degenerirani motiv vezivanja CsrA ne mogu u potpunosti isključiti. Ustanovili smo da je više od 88% (403/455) CsrA izravnih post-transkripcijskih ciljeva destabilizirano u soju MG1655 ( csrA51 ) (dopunska tablica S6). Zajedno s rezultatima prikazanim na slici 2b, naš rad sugerira da CsrA ima važnu ulogu u stabilizaciji velikog broja glasnika.

Metabolički utjecaj izravne regulacije stabilnosti mRNA pomoću CsrA

Ne predviđa se da će direktna regulacija stabilnosti 455 mRNA pomoću CsrA na isti način doprinijeti kontroli metaboličke prilagodbe. Za 356 mRNA, promjena stabilnosti između dva soja nije bila povezana sa značajnom promjenom razine mRNA, koja je općenito potrebna da izazove promjene koncentracije proteina. Za ove mRNA, regulacija stabilnosti uspoređena je regulacijom transkripcije. Te se mRNA uglavnom odnosile na prijevod i transport ugljikohidrata i metabolizam (Dodatna tablica S5). Suprotno tome, za 99 transkripata (dopunska tablica S7) promjene u stabilnosti povezane su s promjenama količine mRNA i stoga mogu pridonijeti metaboličkim razlikama između dva soja.

Preciznije, 64 mRNA destabilizirano je s dolje reguliranom razinom dok je 35 stabilizirano s gore reguliranom razinom između sojeva MG1655 ( csrA51 ) i MG1655 (Dopunska tablica S7). Među destabiliziranim i dolje reguliranim mRNA u soju MG1655 ( csrA51 ), pronašli smo tpiA u skladu s prethodnim rezultatom koji pokazuje da je aktivnost trioza-fosfatne izomeraze pozitivno regulirana CsrA aktivnošću 42 . Identificirali smo i zwf transkript za koji je prethodno izvješteno da ko-pročišćava s CsrA 23, ali njegova stabilnost i količina nikada ranije nisu pokazali da reguliraju Csr sustav. Naši rezultati jasno su pokazali dolje reguliranu stabilnost mRNA i količinu gena koji kodiraju transport ugljikohidrata ( araF, malE, alsB, idnT, melB, glpF, srlAEB i agaVW ) i određene metaboličke putove, npr. Metabolički proces idonata / glukonata ( idnDOT ) i katalakatski galaktonat postupak ( uxaCA) u MG1655 ( csrA51 ) (dopunska tablica S5). pronađena je stabilnost mRNA i razina velikog broja metaboličkih enzima ( aldA, ldhA, udp, yfaU, hdhA, glpK, dmlA, gloB, aes, fdhF, speB, tpx, thiH, ydiB, ilvC, pptA, ebgC i frlB ) da se također negativno reguliraju u MG1655 ( csrA51 ).

U stabiliziranim i gore reguliranim mRNA-ima u soju MG1655 ( csrA51 ), nekoliko gena pripadalo je putovima glikogeneze i glukoneogeneze: maeA, maeB, pck, jazA, pgm i glgB (dopunska tablica S5). Za ekspresiju i / ili aktivnost nekih ovih gena / proteina poznato je da negativno kontroliraju CsrA 36, 42 . Naši rezultati pružaju bolje razumijevanje učinka CsrA na ove ciljeve, koji djeluje na razini stabilnosti i količine mRNA. Otkriveno je da je ekspresija (stabilnost i razina) nekoliko gena Krebsovog ciklusa i metabolizam aminokiselina reguliran u soju MG1655 ( csrA51 ): acnB, fumA, sdhC, leuB, leuC, glnA i asd . Primijetili smo da su se glasnici manose PTS permeaze ( manXYZ ), piridinske nukleotid transhidrogenaze ( pntAB ) i sinteze masnih kiselina ( fabD i fabF ) stabilizirali i pokazali višu razinu u soju MG1655 ( csrA51 ). Mutacija csrA51 također se stabilizira i povećava količinu mRNA koja se odnose na transkripciju ( rpoD kodira vegetativni sigma faktor σ 70 RNA polimeraze) i na prijevod (ribosomalni rplP, rplN i rpsS transkripti). Ovo i nakupljanje glikogena (tablica 1) mogu djelomično objasniti nešto veći prinos biomase u soju MG1655 ( csrA51 ) u usporedbi s MG1655 (tablica 1).

Za 99 mRNA čiji su nivo i stabilnost bili regulirani u soju MG1655 ( csrA51 ), ispitali smo doprinos regulacije stabilnosti u kontroli količine mRNA. Regulatorni koeficijenti izračunati su između MG1655 ( csrA51 ) i MG1655 soja. To kvantificira odgovarajuće učinke regulacije transkripcije i regulacije stabilnosti na količinu mRNA 3 . Za veliku većinu ovih mRNA (85/99), reguliranje stabilnosti pretežno kontrolirane razine mRNA. To ukazuje da je promjena u stabilnosti izazvala različitu količinu mRNA u soju MG1655 ( csrA51 ) i to je točno čak i ako je prisutna regulacija transkripcije; ovu vrstu regulacije nazvali smo degradacijskom kontrolom količine mRNA (Dopunska tablica S7). Svi ovi rezultati daju prvi dokaz kako izravna regulacija (pozitivna / negativna) stabilnosti mRNA pomoću CsrA regulira stotinu količina mRNA neovisno o regulaciji transkripcije i stoga pridonosi kontroli globalnog metabolizma.

Rasprava

U ovom su istraživanju prvi put primijenili integrativni biološki pristup kako bismo dešifrirali transkripcijske i post-transkripcijske uloge CsrA i CsrD. Iako se vjeruje da je Csr sustav uključen u post-transkripcijski odgovor, ovdje je pokazano da protein CsrD sudjeluje u masivnoj pozitivnoj regulaciji transkripcije. Suprotno tome, mutiranje gena csrA inducira i transkripcijske i post-transkripcijske odgovore. Transkripcija više od 500 gena i stabilnost više od 1600 mRNA razlikuju se između sojeva MG1655 ( csrA51 ) i MG1655. Dobijeni su suprotni transkripcijski odgovori u sojevima MG1655 ( csrA51 ) i MG1655 ( c csrD ). Budući da smo potvrdili snažnu regulaciju ekspresije csrD u MG1655 ( csrA51 ), vjerojatno je da je transkripcijski odgovor primijećen u MG1655 ( csrA51 ) barem djelomično posredovao CsrD. Važnost negativnih povratnih informacija stvorenih regulacijom CsrA ekspresije CsrD prethodno je istaknuta u dinamičkom odgovoru Csr sustava 43 . Vrijeme uključivanja i isključivanja CsrA ciljnih proteina ovisilo je o razini ekspresije CsrD. Naše istraživanje pokazuje da regulatorna kontrola Csr sustava uključuje transkripcijsku regulaciju gena povezanu preko CsrA i CsrD (Sl. 6) na cijelom genomu.

Image

Ispunjene strelice predstavljaju vrstu veze "djeluj na", dok prazna strelica predstavlja korelaciju.

Slika pune veličine

Može se predložiti nekoliko mehanizama djelovanja CsrD na transkripcijskoj razini. This may occur indirectly via transcriptional factors whose expressions are CsrD-dependent. Many transcriptional regulators are down-regulated in the absence of CsrD. The actions of CsrD on transcriptional regulators could involve regulation of enzymes of the c-di-GMP signaling pathway, as shown for CsgD 26 . Another possibility is that CsrD regulates the turnover of sRNAs other than CsrB and CsrC 17, which in turn control transcriptional regulator expression at the post-transcriptional level. Finally, we cannot exclude a direct transcriptional effect of CsrD on targeted genes through a still unknown mechanism.

A strong negative correlation between mRNA half-life and its amount has been observed here for the whole genome, indicating that as a general trend mRNA stabilization can be due to a decrease in mRNA amount and vice versa. The regulation of mRNA stability by CsrA was complex for the 1217 transcripts with opposite variations of stability and quantity in MG1655( csrA51 ). For these genes, direct effect of CsrA on stability and the potential indirect effect of CsrA on stability due to change in mRNA level cannot not be discriminated (Fig. 6). Nevertheless for more than 400 mRNAs with stability varying in the same direction as mRNA quantity or not associated with mRNA quantity variation, we predicted that CsrA regulates directly their stability. For the majority of these mRNAs, control may be attributed to a physical interaction between CsrA and the mRNA molecule as indicated by the prediction of a putative binding site and/or high throughput binding analysis. For one third of these mRNAs, there was no experimental proof of CsrA binding 23 and we did not identify any consensus CsrA binding site. Either the sequences of the CsrA binding site were highly degenerated compared to the consensus in these mRNAs or CsrA may act on their stability through other post-transcriptional regulators (such as the RNA-binding protein Hfq) whose expression is CsrA-dependent 39 . About 88% of the half-lives directly regulated by CsrA were shorter in the MG1655( csrA51 ) strain than in the MG1655 strain. This result is surprising because, to date, most of the known targets of CsrA are repressed and/or destabilized, and at the molecular level, examples of repression are more numerous than positive regulation 11, 13, 44, 45, 46 . Thus, contrary to earlier studies on selected targets, our genome-wide analysis shows that CsrA has a significant role as a positive regulator of mRNA stability. The protective effect of CsrA binding on mRNA by sequestering RNase E cleavage sites, only described until now in the case of flhDC 45, might be common.

In terms of gene expression regulation, for one hundred mRNAs, the direct regulation of mRNA stability by CsrA led to a significant variation in mRNA concentration. We confirmed previously identified metabolic targets of CsrA such as glgB, pgm, tpiA and pck mRNAs 36, 42 . In addition, many new direct mRNA targets of CsrA were discovered with a potential metabolic impact via mRNA level changes. Functional analysis of these transcripts underlined that the Csr system is strongly involved in the control of E. coli metabolism by regulating expression of enzymes involved in the central carbon metabolism and carbohydrate transport but also in other specific metabolic pathways (syntheses of amino acids and fatty acids). In the MG1655( csrA51 ) strain, mRNA stability regulation favors gluconeogenesis especially anaplerotic reactions (eg malic enzyme, PEP carboxykinase), whereas the transport of glycolytic substrates (such as sorbitol, melibiose, gluconate, allose, maltose and arabinose) is down-regulated. Therefore, compared to MG1655, the MG1655( csrA51 ) strain is more likely to efficiently metabolize gluconeogenic substrates. Consequently, our results provide the first evidence at the genome-wide scale of the role of CsrA-dependent regulation of transcript stability in metabolic adaptation.

Our study provides new insights into the Csr regulatory network. We determined the extent, the nature and the metabolic effect of the CsrD and CsrA regulations. Our results highlight the superimposition at the genome-wide scale of the transcriptional and post-transcriptional controls that likely contribute to the robustness and dynamics of gene expression reprogramming during bacterial adaptation.

metode

Bakterijski sojevi i plazmidi

E. coli K-12 MG1655 strain (λ F rph −1 ) was the genetic background for mutation of csrA and csrD genes. Mutagenesis was carried out using λ red recombination 47 and primer pair OKT-24/OKT-25. As the csrA gene is essential 29, 30, the ORF was mutated using the csrA mutant obtained by Romeo and coworkers as a model 36 . The MG1655( csrA51 ) strain expresses a truncated variant of CsrA in which 11 amino acids at the C-terminal end of the protein have been deleted. The MG1655(Δ csrD ) strain has a total deletion of the csrD gene, which was obtained from the KEIO collection 29 . The mutations were transferred into E. coli K-12 MG1655 wild type background by P1 phage-mediated transduction before removing the antibiotic-resistance cassette by FLP recombination. MG1655( csrA51 ) strain was complemented by a low copy number plasmid containing the wild type csrA gene. Briefly, csrA was amplified using primer pair OCT-29/OCT-30 and cloned in pSAB11 48 at Eco RI site. To perform gene expression assays, csrC - lacZ, glgB - lacZ, frdA - lacZ and ydeH - lacZ transcriptional fusions were constructed. The transcriptional fusions were cloned in pJYB79 (CmR), a plasmid that was constructed by inserting the omegon kan from pHP45-kan into pACYC184 using the restriction site Bam HI and subsequently by cloning at Pst I site a PCR amplified fragment containing plac- lacZ from E. coli . First, a 5′UTR sequence containing a ribosome binding site and a start codon (GAATTCCCGGGGATCCTAAGTAAGTAAGGAGAAAAAAATGGCTGATCCC) was fused to lacZ 10 th codon. Then, the vector was amplified by PCR with primers MBO-200/-199 and assembled with the promoter regions using In-Fusion® HD cloning kit (Clontech). The promoters regions upstream of the transcription starts of csrC (249 nt), glgB (200 nt), frdA (205 nt) and ydeH (421 nt) were amplified on MG1655 genomic DNA with oligonucleotide pairs MBO-137/-138, MBO-203/-204, MBO-207/-208 and MBO-197/-198, respectively. For glgB, frdA and ydeH , the promoter regions that were chosen using information available on the EcoCyc E. coli Database listing previously characterized transcriptional regulators. For csrC , the promoter region is as used in Suzuki et al . 17 . The strains and plasmids were validated by sequencing. The oligonucleotides are listed in Table S8.

Culture conditions

For RNA extraction and microarray analysis, cells were grown in continuous culture at 37 °C in M9 minimal medium supplemented with glucose as described 3 . The MG1655, MG1655( csrA51 ) and MG1655(Δ csrD ) strains were cultured at the same growth rate, μ = 0.10 h −1, which corresponds to doubling time of 6.9 h. Each culture was repeated three times to provide independent biological replicates. Biomass was estimated from absorbance at 600 nm (Libra S4, Biochrom): 1 unit of absorbance corresponding to 0.42 g of dry cell weight l −1 for the MG1655 strain, 0.27 g of dry cell weight l −1 for the MG1655( csrA51 ) strain and 0.44 g of dry cell weight l −1 for the MG1655(Δ csrD ) strain. To determine the maximal growth rate of each strain, the strains were grown in batch culture (identical medium, oxygen concentration, pH and temperature) and the rates were determined in exponential growth phase.

Sampling and RNA extraction

Sampling and RNA extraction were conducted as described 3 with additional cell samplings after rifampicin addition at 9, 15, 20 and 30 min.

Northern Blot

For each sample, 10 μg of total RNA was denatured for 5 min at 95 °C in RNA loading buffer (95% [v/v] formamide, 0.1% [w/v] xylene cyanole, 0.1% [w/v] bromphenol blue, 10 mM EDTA), separated on a 7 M urea/6% polyacrylamide gel at 250 V and transferred to Hybond-XL membranes (GE Healthcare) by electroblotting (1 h, 50V, 4 °C) in 1X TBE. After UV crosslinking, the membranes were hybridized overnight in Roti®-Hybri-Quick (Roth) at 65 °C with [ 32 P] body-labeled riboprobes specific of CsrB (primers OCT-50/OCT-51) or CsrC (primers OCT-52/OCT-53) or at 42 °C with a 5S specific [ 32 P] end-labeled oligonucleotide (MBO-59). Hybridization with CsrB or CsrC riboprobe is followed by 15 min washes in 2X, 1X and 0.1X SSC/0.1% SDS solutions at 65 °C. Hybridization with 5S oligonucleotide is followed by 15 min washes in 5X, 1X and 0.1X/0.1% SDS solutions at 42 °C. Hybridization signals were quantified on a PhosphorImager (Typhoon Trio – GE Healthcare) with MultiGauge software (Fujifilm).

Postupci mikrorasta

A double-stranded cDNA synthesis kit (InvitroGen) was used to produce cDNA from 2 μg of total RNA. cDNA (1 μg) was labeled using the one color DNA labeling kit (Nimblegen – Roche) and labeled cDNA (2 μg) was hybridized onto E. coli K-12 gene expression arrays (Nimblegen – Roche) for 17 h at 42 °C according to the manufacturers' instructions. Arrays were washed and then scanned with a MS200 Microarray Scanner (Nimblegen – Roche). The images were analyzed with DEVA 1.2.1 software. Only raw data were used for further analyses. All array procedures were performed by the GeT-Biopuces platform (//get.genotoul.fr).

mRNA level and half-life determination

mRNA quantity determination by transcriptomic analysis was conducted as described 3 . Intensity values were multiplied by the total RNA extraction yield (in μg total RNA per mg of dry cell weight) to provide mRNA amount value in arbitrary units per mg of dry cell weight. RNA extraction yields were 13.1 ± 2.2, 8.7 ± 0.9 and 8.9 ± 1.5 μg RNA per mg of dry cell weight for the MG1655, MG1655( csrA51 ) and MG1655(Δ csrD ) strains, respectively. Differences in mRNA level were evaluated as described in 3 . The P-values were adjusted for multiple testing by the 'Benjamini and Hochberg' (BH) false discovery rate method 49 . Differences in mRNA quantity were considered as significant for adjusted P-values lower than 1% and log 2 fold change (Log 2 FC) higher than 0.5 or lower than −0.5. mRNA half-life determination was performed as previously described 3 . The statistical significance of differences in half-life was evaluated using the probability value of interaction between time and the type of strain (MG1655, MG1655( csrA51 ) or MG1655(Δ csrD )) in a global model of linear regression. A statistical threshold of 10% was used for adjusted P-values by the “BH” false discovery rate method 49 .

Determination of mRNA level regulatory coefficients

For the selected mRNAs, the coefficient ρ D, corresponding to the relative contribution of the mRNA stability regulation in the control of mRNA level was calculated as previously described 3 using data of mRNA stability and quantity obtained in the MG1655( csrA51 ) and MG1655 strains. Regulatory classes were defined according to the ρ D value: 0 < ρ D < 0.6, mRNA quantity mainly controlled by transcription or controlled by both transcription and mRNA stability; 0.6 < ρ D, mRNA quantity mainly controlled by mRNA stability.

Enrichment methods

R free statistical software (www.r-project.org) was used for enrichment methods. Functional categories enriched in transcript subgroups were determined by a hypergeometric test on data using the Biological Process of Gene Ontology annotation database (GO project; //www.geneontology.org/). Only GO terms with associated P-value ≤ 0.05 were considered as significant.

In silico research of CsrA binding sites

To determine if an mRNA contained a potential CsrA binding site, the software PatScan was used 50 . The SELEX-derived consensus RUACARGGAUGU was searched in a −100/+100 nt window (+1 corresponding to the start codon) allowing a maximum of 5 mismatches. Subsequently, only sequences that included a conserved GGA motif were considered as a potential CsrA binding site.

Analitičke metode

Glucose and acetate concentrations were measured by HPLC coupled to a refractometer and with UV detection. The device was equipped with a Bio-Rad HPX87H column maintained at a temperature of 48 °C and 5 mM H 2 SO 4 was used as the eluent, at a flow rate of 0.5 ml min −1 . Glycogen staining by iodine vapor, biofilm formation by cristal violet staining and motility assays on 0.3% agar plate were carried out as previously described 51 . The intracellular glycogen quantification was done as previously described 52 . Briefly, the cells were lysed to extract the glycogen which was then hydrolyzed by amyloglucosidase into glucose subunits. The glucose subunits were then quantified using glucose oxidase coupled to the colorimetric reagent o-dianisidine dihydrochloride. Three independent experiments were performed for each assay.

The csrC - lacZ, glgB - lacZ, frdA - lacZ and ydeH - lacZ gene expression assays were performed using cells grown in batch culture at 37 °C in M9 minimal medium supplemented with fructose (2.7 gL −1 ), casamino acids (0.2%) and chloramphenicol (25 μg.ml −1 ). Under these conditions, the MG1655, MG1655( csrA51 ) and MG1655(Δ csrD ) strains have similar growth rates (0.39 h −1, 0.39 h −1 and 0.31 h −1 respectively). These conditions aimed at mimicking growth in continuous cultures. In exponential growth, the cells were centrifuged, suspended in Tris (6 mM)/Tricarballylate (1.8 mM) buffer pH 7.2 and lysed mechanically with glass beads. β-galactosidase activity was assayed using 2.5 mM orthonitrophenyl-β-galactoside 53 . Total protein was measured by the Bradford method with bovine serum albumin as the protein standard 54 . Three independent experiments were performed for each assay.

dodatne informacije

How to cite this article : Esquerré, T. et al . The Csr system regulates genome-wide mRNA stability and transcription and thus gene expression in Escherichia coli. Sci. Rep. 6, 25057; doi: 10.1038/srep25057 (2016).

Dodatna informacija

PDF datoteke

  1. 1.

    Dodatna informacija

Excel datoteke

  1. 1.

    Dopunska tablica S1

  2. 2.

    Dopunska tablica S2

  3. 3.

    Dopunska tablica S3

  4. 4.

    Dopunska tablica S4

  5. 5.

    Dopunska tablica S5

komentari

Slanjem komentara slažete se s našim Uvjetima i smjernicama zajednice. Ako ustanovite da je nešto zloupotrebno ili nije u skladu s našim uvjetima ili smjernicama, označite to kao neprimjereno.