U ne-transformiranim stanicama bak se aktivira gubitkom anti-apoptotičkih bcl-xl i mcl-1, ali u nedostatku aktivnih bh3 samo proteina | stanična smrt i bolest

U ne-transformiranim stanicama bak se aktivira gubitkom anti-apoptotičkih bcl-xl i mcl-1, ali u nedostatku aktivnih bh3 samo proteina | stanična smrt i bolest

Anonim

teme

  • apoptoza
  • Stanična signalizacija

Sažetak

Mitohondrijsku apoptozu kontroliraju proteini iz B-staničnog limfoma 2 (Bcl-2). Pro-apoptotički članovi ove obitelji, poznati kao BH3-samo proteini, pokreću aktivaciju efektora Bcl-2-povezanih X proteina (Bax) i Bcl-2 homolognog antagonista / ubojice (Bak), čemu se suprotstavlja anti-apoptotička obitelj članovi. Kako interakcije Bcl-2 proteina reguliraju smrt stanica još uvijek nije posve jasno. Ovdje pokazujemo da se u nedostatku vanjskih apoptotskih podražaja Bak aktivira bez uočljivog doprinosa proteina samo za BH3, a opstanak stanica ovisi o anti-apoptotičkim Bcl-2 molekulama. Svi anti-apoptotični Bcl-2 proteini ciljani su samo putem RNA interferencije ili u kombinacijama dva u primarnim ljudskim fibroblastima. Istodobna ciljanja B-staničnog limfoma-ekstra velike i mijeloidne leukemije, niz leukemije 1, doveli su do apoptoze u nekoliko tipova stanica. Apoptoza je ovisila o Baku, dok je Baxu bio potreban. Aktivator proteina samo za BH3 nije potreban za indukciju apoptoze jer je apoptoza nepromijenjena u odsustvu svih proteina samo za BH3 za koje se zna da direktno aktiviraju Bax ili Bak, posrednika stanične smrti koji djeluje na Bcl-2, agonista smrti domene koji utječe na BH3 i p53 -regulirani modulator apoptoze. Ovi nalazi argumentiraju autoaktivaciju Baka u nedostatku anti-apoptotičkih Bcl-2 proteina i pružaju dokaze o dubokim razlikama u aktivaciji Baxa i Baka.

Glavni

Regulirana eliminacija stanica apoptozom je ključni mehanizam razvoja, homeostaze i obrane tkiva. Kod kralježnjaka se apoptoza regulira kroz dva puta, putem recepcije smrti (vanjski) i mitohondrijskim (unutarnjim), koji se aktiviraju brojnim apoptotskim podražajima. Mitohondrijsku apoptozu karakterizira gubitak integriteta vanjske membrane mitohondrija i oslobađanje proteina mitohondrijskog međumembranskog prostora, ponajviše citokroma c , što dovodi do aktiviranja kaspaze kaspaze-9 i efektora. 1

Oslobađanje citokroma c upravljaju proteinima iz skupine B-staničnih limfoma 2 (Bcl-2). 2 Obitelj Bcl-2 sastoji se od tri skupine čija ekspresija i interakcija odlučuju o preživljavanju stanica. Anti-apoptotični Bcl-2 proteini uključuju Bcl-2, Bcl-X L (B-stanični limfom-izuzetno velik), Bcl-w (Bcl-2-sličan protein 2), Mcl-1 (sekvenca leukemije mijeloidnih ćelija 1) i A1 (protein A1 povezan s Bcl-2). Pro-apoptotička skupina proteina samo za BH3 (koja sadrži domenu BH3: Bim (Bcl-2-posrednik posrednik stanične smrti), Bid (agonist smrti domene koji utječe na BH3), Puma (p53-regulirani modulator apoptoze), Noxa (Phorbol-12-miristat-13-acetat-inducirani protein 1), Bad (Bcl-2-povezani promotor smrti), Bik (Bcl-2-ubojica koji djeluje) i Hrk (aktivator apoptoze hara-kiri) aktiviraju pro-apoptotički efektori Bcl-2-povezani X protein (Bax) i Bcl-2 homologni antagonist / ubojica (Bak). Bax i Bak mogu se međusobno zamijeniti u većini situacija, ali prisutnost jednog od njih potrebna je za mitohondrijsku apoptozu. Nakon aktivacije, Bax i Bak tvore oligomere u vanjskoj mitohondrijskoj membrani i uzrokuju oslobađanje citokroma c . Kako se aktiviraju Bax i Bak, još se raspravlja. Predloženi su i istraženi različiti modeli aktivacija.

Prema modelu izravne aktivacije proteini samo za BH3 mogu izravno, fizičkom interakcijom, aktivirati Baxa i Baka. 3 Model je izveden u istraživanjima sintetskih peptida BH3 domene u in vitro sustavima, to jest izoliranih mitohondrija ili liposoma, gdje su peptidi koji obuhvaćaju BH3-domene Bim ili Bida ('aktivator' proteina koji su jedini za BH3) bili u stanju aktivirati Bax. Peptidi dobiveni iz proteina samo za BH3 Bad, Bik, Hrk, Noxa ili Puma nisu aktivirali Bax izravno. Međutim, ti se peptidi mogu vezati na anti-apoptotičke Bcl-2 proteine ​​uz različite preferencije. 4 Budući da ovo može neutralizirati kombinaciju anti-apoptotičkih proteina, to može olakšati Bax / Bak-aktivaciju aktivatorom samo proteina BH3. Slijedom toga, ova skupina proteina koji su jedini za BH3 nazvana je proteinima samo za senzitiv ili „derepresiv“. 3, 5, 6, 7 Model izravne aktivacije nedavno je dobio podršku strukturnih studija aktivatorskih BH3 domena vezanih za Bax. 8 Ova je studija također otkrila da prethodno korišteni peptidi samo za BH3 nisu imali ostatak koji je važan u aktivaciji Baxa, pa će možda biti potrebno preispitati prethodne rezultate. Zapravo, nedavna studija pokazuje da postavljanje domene BH3 iz različitih proteina samo za BH3 u netaknuti Bid protein povećava Bax / Bak-aktivacijski kapacitet BH3 domena Bid, Bim, Puma, Bmf (Bcl-2-modificirajući faktor ), Bik i Hrk. 9

Model s istiskivanjem (ili neizravnom aktivacijom) s druge strane kaže da se Bax i Bak drže pod kontrolom anti-apoptotičkim Bcl-2 proteinima i automatski se aktiviraju kada je ova interakcija prekinuta s proteinima koji su jedini za BH3 (pomicanje). Proteini samo za BH3 mogu se vezati za anti-apoptotične Bcl-2 proteine ​​i nakon apoptotske stimulacije mogu prouzročiti premještanje tih proteina iz Baxa i Baka, što može dovesti do aktiviranja efektora. BH3-peptidi izvedeni iz Bim-a i Pume mogu se vezati za sve anti-apoptotičke Bcl-2 proteine ​​i njihove odgovarajuće proteine ​​koji djeluju ubijanjem nakon prekomjerne ekspresije, dok Bad, Bmf, Bid, Bik, Hrk i Noxa prikazuju obrasce vezanja ograničene na određene anti-apoptotičke Bcl -2 proteina. 4 Stoga se sugerira da aktiviranje Bax / Baka zahtijeva neutralizaciju / istiskivanje nekoliko anti-apoptotičkih proteina, što se može postići jednim bh-proteinom širokih svojstava vezivanja (kao što je Bim) ili kombinacijom proteina samo za BH3 s ograničenim sposobnostima vezivanja (na primjer Bad + Noxa). 10, 11

Modeli su dodatno usavršeni; model 'ugrađeni zajedno' dodatno razmatra dinamičku interakciju proteina s mitohondrijskom membranom, 12 i predloženo je da se modeli mogu objediniti uzimajući u obzir dva "načina" inhibicije: anti-apoptotični Bcl-2 proteini imaju dvostruka funkcija u inaktivaciji oba, bh3 samo proteina i efektora. Pro-apoptotički signali uzrokuju oslobađanje aktivatornih proteina BH3 samo iz sekvestracije sa anti-apoptotičkim Bcl-2 proteinima. Slobodni proteini koji djeluju samo na BH3 izravno aktiviraju efektore, međutim, stanična smrt se još uvijek ne može započeti jer se efektori tada kontroliraju anti-apoptotičkim Bcl-2 proteinima. Za aktiviranje efektora potreban je slobodni protein samo za BH3. 13

Ovaj model objedinjuje dva gornja modela u smislu da uključuje aspekte i inhibicije i pomaka, kao i izravne aktivacije. Međutim, čini se da je srž razlike između (izravne) aktivacije i modela pomaka nepomirljiva: u aktivacijskom modelu Bax i Bak nisu aktivni ako ne dobiju poticaj iz proteina samo za BH3, dok su u modelu istiskivanja aktivni ukoliko nisu vezani za anti -apoptotski proteini. Stoga, u nedostatku svih ostalih proteina, jedan model predviđa da su Bax / Bak aktivni, drugi da su neaktivni. Očito ne mogu biti oboje.

Model izravne aktivacije početno je uspostavljen s Baxom, a model istiskivanja s Bakom. Podaci su vrlo snažni da se Bax aktivira izravnom interakcijom s proteinima samo BH3. Rekombinantni Bak također se može izravno aktivirati rekombinantnim tBid, 14, a Bid / BH3-kimere mogu aktivirati rekombinantni Bak bez njegovog C kraja. 9 Međutim, s obzirom da se Bak obično ubacuje u vanjsku mitohondrijsku membranu gdje se može vezati za brojne druge članove obitelji Bcl-2, bilo je teško izravno testirati aktivaciju Baka u fiziološkoj situaciji.

Jedna mogućnost 'objedinjavanja' originalnih modela može biti u modelu u kojem se Bax fiziološki aktivira izravnom aktivacijom (Bax je neaktivan dok ne primi signal preko proteina samo za BH3), dok se Bak aktivira neizravno (automatski se aktivira kada inhibicija Bcl Rasprostire se proteini -2 slični). Ovdje testiramo ovu mogućnost neizravne Bakove aktivacije. Ciljali smo anti-apoptotične Bcl-2 obiteljske proteine ​​pomoću RNAi. U ovom su okruženju koncentracije proteina i uvjeti fiziološki, što izbjegava neke probleme povezane s pretjeranom ekspresijom ili eksperimentima bez stanica. Ne-maligne stanice mogu drugačije reagirati na gubitak anti-apoptotičnih Bcl-2 proteina u usporedbi s stanicama tumora. 15 U ovom istraživanju, koristeći nemaligne stanice, ciljali smo na sve anti-apoptotičke Bcl-2 molekule u kombinaciji dvije. U nedostatku apoptotskih podražaja uočili smo da je kombinirani gubitak Bcl- XL i Mcl-1 dovoljan da inducira apoptozu. Proteini izravnog aktivatora Bid, Bim i Puma nisu bili potrebni. Ova zapažanja daju dokaz za neizravno aktiviranje Baka.

Rezultati

Kombinirano ciljanje Bcl-X L i Mcl-1 inducira apoptozu u primarnim ljudskim stanicama

Nedavno smo istraživali anti-apoptotične Bcl-2 proteine ​​da bismo procijenili strategiju induciranja apoptoze na tumor specifičan način i primijetili smo da - za razliku od tumorskih stanica - ciljanje jednog anti-apoptotičnog Bcl-2 proteina RNAi ne utječe na opstanak primarnih (ne-transformiranih) ljudskih fibroblasta. 15 Da bismo razumjeli da li su za preživljavanje potrebni neki anti-apoptotički proteini, analizirali smo učinak kombiniranog istodobnog RNAi na dva anti-apoptotička Bcl-2 proteina. Sve kombinacije dva anti-apoptotička Bcl-2 proteina, Bcl-2, Bcl- XL, Bcl-w, Mcl-1 i A1 testirane su i postignuto je učinkovito ciljanje svih proteina (slika 1a i br. 15 za A1). Iako većina kombinacija nije dovela do značajne stanične smrti, ciljanje Bcl-X L i Mcl-1 ubilo je oko 60% stanica u roku od 3 dana (Slika 1b; manje cjelovita studija u stanicama HeLa također je izvijestila da je istovremeno ciljanje Bcl- XL i Mcl-1 induciraju apoptozu 16 ). U manjoj mjeri, ciljanje Bcl-X L i Bcl-w uzrokovalo je staničnu smrt, međutim primijećena je indukcija Noxa (podaci nisu prikazani). Noxa inaktivira Mcl-1, a eksperimentalna ekspresija Noxa senzibilizira stanice na RNAi samo protiv Bcl-X L (vidjeti dolje). Stanična smrt nakon ciljanja Bcl-X L / Bcl-w stoga ne može biti posljedica gubitka Bcl-2 funkcije, već noksativacijom Mcl-1 posredovanom Noxa, zajedno s RNAi protiv Bcl-X L ; ovo ciljanje može stoga imati isti molekulski učinak kao RNAi u odnosu na kombinaciju Bcl- XL i Mcl-1. Stoga se važnost Bcl-X L / Bcl-w za staničnu smrt ne može riješiti u ovom pristupu. Aktiviranje kaspaze-9 i kaspaze-3 uočeno je zapadnim upijanjem (slika 1c). Primijećeno je i cijepanje kaspaze-8, što je vrlo vjerojatno uslijedilo nakon aktiviranja efektorskih kaspaza.

Image

Kombinirana inhibicija Bcl- XL i Mcl-1 inducira apoptozu u primarnim stanicama. ( a ) Primarni humani fibroblasti istovremeno su transficirani s dva siRNA kao što je naznačeno. Ekspresija proteina je izmjerena 48 sati nakon transfekcije imunoblotingom. α -Tubulin je služio kao kontrola opterećenja. Rezultati su reprezentativni za tri neovisna pokusa. ( b ) Stanična smrt fibroblasta izmjerena je kvantificiranjem pozitivnih stanica Anexin V- i propidium jodida (PI) 3 dana nakon liječenja siRNA. Prikazivanje podataka znači ± SD od tri neovisna pokusa. ( c ) Aktivacija kaspaze u fibroblastima koja je procijenjena imunoblotiranjem 48 sati nakon tretiranja siRNA. Podaci su reprezentativni za dva neovisna pokusa. ( d ) Fibroblasti su transficirani s naznačenim siRNA. Četrdeset osam sati nakon siRNA transfekcijske stanice transficirane su noxa-kodirajućim ili praznim plazmidom. Stanična smrt mjerena je 24 sata nakon transfekcije plazmidom. Prikazivanje podataka znači ± SD od tri neovisna pokusa. ( e ) Stanična vitalnost procijenjena je 3 dana nakon transfekcije siRNA primarnim ljudskim fibroblastima, primarnim ljudskim keratinocitima i besmrtnim ljudskim mikrovavaskularnim endotelnim stanicama (HMEC1). Podaci se daju kao sredstvo ± SD od tri neovisne transfekcije. * P ≤ 0, 05

Slika pune veličine

Da bismo potvrdili ovaj nalaz u drugom okruženju, ektopički smo izrazili Noxu zajedno sa ciljanju posredovanim siRNA-om Bcl-2, Bcl-X L i Bcl-w. Tek nakon ciljanja Bcl-X L, Noxa ekspresija je dovela do apoptoze. Kako Noxa izričito cilja Mcl-1, to je dodatni dokaz da posebno Mcl-1 inaktivacija zajedno s Bcl-X L ciljanjem dovodi do smrti stanice (Slika 1d). Konačno, testirali smo ovu kombinaciju na različitim tipovima stanica i uspoređivali primarne ljudske fibroblaste (mezenhimske stanice) s primarnim ljudskim keratinocitima (epitelne stanice) i besmrtnim ljudskim mikrovavaskularnim endotelnim stanicama. Ciljanje Bcl-X L i Mcl-1 uzrokovalo je staničnu smrt i kod ovih tipova stanica (Slika 1e). Ti podaci pokazuju da posebno kombinirani gubitak Bcl-X L i Mcl-1 izaziva smrt stanica u velikom broju različitih primarnih stanica bez daljnjeg podražaja.

Apoptozu pri ciljanju Bcl-X L i Mcl-1 posreduje Bak

Zatim smo testirali važnost protektora efektora Bcl-2 Bax i Bak za apoptozu uzrokovanu gubitkom Bcl-X L i Mcl-1. Uspjeli smo srušiti ekspresiju bilo kojeg efektora zajedno s Bcl-X L / Mcl-1 (Slika 2a). Iznenađujuće, ciljanje Baka gotovo je u potpunosti blokiralo staničnu smrt, dok ciljanje Baxa nije imalo značajnog utjecaja na staničnu smrt (Slika 2b). Izmjerili smo i udio stanica sa aktiviranim Baxom, upotrebljavajući bojanje za 6A7 epitop u aktivnom Baxu. Otkriveno je da se Bax aktivirao nakon ciljanja Bcl-X L / Mcl-1 (slika 2c). Međutim, nije primijećena aktivacija kada je Bak istodobno bio ciljan, što sugerira da je Bax-ova aktivacija sekundarna od Bakove aktivacije, ali Bax se ne može aktivirati u njegovoj odsutnosti (Slika 2c).

Image

Apoptozu nakon inhibicije Bcl- XL i Mcl-1 posreduje Bak. ( a ) Primarni humani fibroblasti su transfektirani s naznačenim siRNA. Ekspresija proteina je izmjerena 48 sati nakon liječenja siRNA. Rezultati su reprezentativni za tri neovisna pokusa. ( b ) Fibroblasti su tretirani kako je opisano u a stanična smrt kvantificirana je 3 dana nakon transfekcije. Podaci su navedeni kao sredstvo ± SD od tri neovisna pokusa. ( c ) Fibroblasti su tretirani kao što je opisano u a aktivacija Baxa je kvantificirana citometrijom nakon bojenja s antitijelom specifičnim za aktivirani Bax. Prikazivanje podataka znači ± SD od najmanje tri neovisna pokusa. * P ≤ 0, 05; ns, nije značajno

Slika pune veličine

Apoptoza nakon ciljanja Bcl-X L i Mcl-1 u mišjim embrionalnim fibroblastima ovisi o Baku

Da potvrdimo Bakovu ovisnost apoptoze uzrokovanu gubitkom Bcl-X L / Mcl-1, koristili smo WT mišje embrionalne fibroblaste (MEF) ili nedostatnu za Bak, Bax ili dvostruko deficitarnu za obje. Propadanje Mcl-1 i Bcl-X L je također bilo učinkovito u tim stanicama (slika 3a). Slično ljudskim fibroblastima, ciljanje Bcl-X L / Mcl-1 inducirane apoptoze u WT-MEF-u, što nije primijećeno u Bax / Bak-DKO-MEF (Slika 3b). Iako je apoptoza u MEF-ima s nedostatkom Baxa bila slična razinama u WT-MEF-u, značajno je smanjena u MEF-ima sa nedostatkom Baka (Slika 3c). Bilo je i vrlo malog pro-apoptotičkog učinka također u stanicama s nedostatkom Baka (Slika 3C). Ovo može biti učinak ovisan samo o BH3 (na primjer, ciljanje anti-apoptotskih proteina može otpustiti neki Bim), ili može biti u nedostatku Bcl-X L, koji Bax može retro-translocirati iz mitohondrije do citosola17. Akumulacija Baxa u mitohondrijama će imati mali pro-apoptotički učinak. Učinak je, međutim, bio minimalan u usporedbi s učinkom Baka (sugerirano učinkom u stanici koja je imala nedostatak Baxa u odnosu na Bak, slika 3c).

Image

Bakina ovisna apoptoza o inhibiciji Bcl- XL i Mcl-1 u mišjim embrionalnim fibroblastima od knockout miševa. ( a ) MEF iz Bax ili Bak-deficitarnih, ili WT miševa tretirani su siRNA tijekom 3 dana i izmjerena je ekspresija proteina. Rezultati su reprezentativni za tri neovisna pokusa. ( b ) MEF-ovi iz Bax / Bak-dvojno deficitarnih ili WT miševa tretirani su siRNAs i stanična smrt je analizirana 3 dana nakon transfekcije. Prikazivanje podataka znači ± SD od tri neovisna pokusa. ( c ) MEF-ovi miševa sa nedostatkom Bax-a ili Baka ili WT tretirani su i analizirani kako je opisano u b . Mala razlika u staničnoj smrti nakon ciljanja Bcl-X L i Mcl-1 u stanicama nedostatnim za Bak bila je statistički značajna ( P = 0, 048, kontrola u odnosu na stanice kojima nedostaje Bak). ( d ) MEF-ovi miševa s manjkom Mcl-1 tretirani su naznačenim siRNA i analizirani 24 sata nakon tretmana. Inhibicija Bcl-X L je dovoljna u ovim stanicama da inducira staničnu smrt. Prikazivanje podataka znači ± SD od tri neovisna pokusa. * P ≤ 0, 05; ns, nije značajno

Slika pune veličine

Također smo testirali MEF-ove nedostatke MEF-ova. Ovdje je ciljanje Bcl-X L bilo dovoljno za izazivanje stanične smrti i opet, stanična smrt ovisila je o Baku, ali ne i o Baxu (Slika 3d). Zajedno, ovi rezultati potvrđuju nalaze o mišjim embrionalnim fibroblastima u različitim situacijama deficita Bcl-2 proteinskih obitelji.

Apoptoza nakon inhibicije Bcl-X L / Mcl-1 započinje u nedostatku izmijenjenih nivoa ekspresije proteina samo za BH3

Gubitak Bcl-X L / Mcl-1 dovodi do aktivacije Baka. To bi moglo biti posljedica ili oslobađanja Bak-a iz ove dvije anti-apoptotičke molekule ili izravne aktivacije Bak-a od strane proteina samo za BH3, koji se može osloboditi iz Bcl-X L / Mcl-1 ili povećati u ekspresiji. Prvo smo testirali razine ekspresije samo proteina BH3 s poznatom sposobnošću da izravno aktiviraju efektorske Bcl-2 proteine, naime Bim, Bid i Puma. Bim-mRNA nije izmijenjena nakon ciljanja Bcl-X L / Mcl-1 dok su razine proteina iznenađujuće smanjene (Slika 4a). Ponuda mRNA nije izmijenjena; međutim, primijećeno je neznatno smanjenje razine bid proteina, dok tBid nije detektiran (slika 4b). Ne može se u potpunosti isključiti da smanjene razine ponude predstavljaju aktiviranje ponude čak i bez tBid-a koji se može otkriti. Stoga smo testirali da li su razine ponuda također smanjene u nedostatku Baka. Nakon ciljanja Baka nije utvrđeno da će razine licitacije biti smanjene (slika 4b, desna ploča), što sugerira da - ako smanjene razine ponude predstavljaju aktivaciju ponude - licitacija se može aktivirati nizvodno od Baka na neizravni način, ali nije kritična za indukciju apoptoze. Razine mRNA bazalne Pume nisu značajno izmijenjene (Slika 4c) i Puma protein nije otkriven u tim stanicama (podaci nisu prikazani). Razine Noxa, često regulirane transkripcijom, procijenjene su pomoću RT-PCR. Razine noxa mRNA bile su povećane, ali na način ovisan o Baku, što sugerira aktiviranje nizvodno od Baka (slika 4d). Noxa posebno antagonizira Mcl-1 i A1. 4 Budući da je Mcl-1 već ciljao siRNA, a kombinirana inhibicija Bcl-X L / A1 nije dovela do apoptoze (slika 1b). Noxa vjerojatno neće utjecati na apoptozu nakon liječenja Bcl-X L / Mcl-1-siRNA. Nisu primijećene promjene razina mRNA Bad ili Bik (Slika 4e i f), dok je Hrk, međutim, reguliran na Bakin način (Slika 4g).

Image

Apoptoza nakon inhibicije Bcl-X L / Mcl-1 započinje u odsustvu izmijenjenih nivoa ekspresije proteina samo za BH3. ( a ) Primarni humani fibroblasti su tretirani s Bcl-X L / Mcl-1 ili Ctrl siRNA. Ekspresija pro-apoptotičkog Bima kvantificirana je 3 dana nakon transfekcije na RNA (lijeva ploča) ili na razini proteina (desna ploča). Podaci pokazuju da ± SD i imunobloti predstavljaju tri neovisne transfekcije. ( b ) Analiza pro-apoptotičke ponude u fibroblastima liječenim naznačenim siRNA tijekom 3 dana. Podaci pokazuju da ± SD i imunobloti predstavljaju tri neovisne transfekcije. ( c - g ) Analiza Puma, Noxa, Bad, Bik i Hrk u fibroblastima kako je opisano u b . Podaci pokazuju da ± SD i imunobloti predstavljaju tri neovisne transfekcije

Slika pune veličine

Podaci zajedno, podaci upućuju na to da se većina proteina samo za BH3 ne inducira. Neki proteini samo za BH3 inducirani su na način ovisan o Baku, što sugerira da je ova indukcija nizvodno od Baka. Stoga promjene u ekspresiji ovih molekula vrlo vjerojatno ne djeluju kao okidač za pokretanje apoptoze.

Individualni proteini samo za BH3 nisu potrebni za indukciju apoptoze nakon gubitka Bcl-X L / Mcl-1

Da bismo pobliže ispitali važnost proteina samo za BH3, testirali smo je li oborjenje proteina samo za BH3 utjecalo na apoptozu nakon ciljanja Bcl-X L / Mcl-1. U ljudskim fibroblastima smo utišali Bima, Bida, Bad ili Pumu od strane RNAi. liječenje siRNA snažno je smanjilo razinu mRNA ciljanog gena (Slika 5a). Međutim, na indukciju apoptoze nije utjecala kada bilo koja od ovih molekula ciljano zajedno s Bcl-X L / Mcl-1 (Slika 5b). Studije su također proširene na MEF-ove sa nedostatkom Mcl-1, gdje su istovremeno ciljana dva proteina samo za BH3, opisana za izravno aktiviranje Baxa ili Baka. Nisu primijećene promjene indukcije apoptoze (slika 5c i d).

Image

Pojedinačni proteini samo za BH3 nisu potrebni za indukciju apoptoze nakon gubitka Bcl-X L / Mcl-1. ( a ) Primarni humani fibroblasti su transficirani Bcl- XL i Mcl-1 siRNA zajedno s kontrolom ili siRNA specifičnom za Bim, Bid, Pumu ili Bad, kako je naznačeno. Ekspresija gena analizirana je 24 sata nakon transfekcije. ( b ) Primarni humani fibroblasti tretirani su siRNA kao što je naznačeno. Stanična smrt mjerena je 3 dana nakon transfekcije. ( c ) MEF-ovi miševa s manjkom Mcl-1 tretirani su s dva siRNA kao što je naznačeno. razine mRNA izmjerene su 24 sata nakon transfekcije. ( d ) MEF-ovi manjkavi MEF-ovi su transfektirani s dva BH3-a ciljana ili kontrolna siRNA-a kako je naznačeno. Četrdeset osam sati nakon transfekcije, stanice su transficirane Bcl- XL ili kontrolnim siRNAs, a stanična smrt mjerena je 24 sata kasnije. Za - d, prikaz podataka znači ± SD od tri neovisna pokusa. * P ≤ 0, 05; ND, nije određeno

Slika pune veličine

Ovi podaci sugeriraju da pojedinačni proteini samo za BH3 nisu potrebni za apoptozu uzrokovanu gubitkom Bcl-X L i Mcl-1, što dalje daje dokaze da je uklanjanje Bcl-X L i Mcl-1 dovoljno da izazove staničnu smrt.

Apoptoza izazvana inhibicijom Bcl-X L / Mcl-1 nastaje u odsustvu proteina samo za aktivator BH3

Dalje smo testirali može li kombinirana inhibicija proteina poznatih samo za aktivator BH3 utjecati na staničnu smrt. Koristili smo MEF-ove nedostatke MEF-a i uspješno utišali Bim-a, Bida i Puma-u (slika 6a). Čak i istovremeno obaranje ovih molekula nije utjecalo na indukciju apoptoze (Slika 6b). Zatim smo koristili MEF-ove koji su nedostajali Bimu i Pumi. Ciljanje Bcl-X L / Mcl-1 izazvalo je apoptozu u sličnoj mjeri kao i kod WT-MEF (Slika 6c). Ponuda je zatim uspješno usmjerena u ove stanice siRNA, osiguravajući drugi stanični model u kojem su svi proteini samo za aktivator BH3 reducirani (Slika 6d). Opet, stanična smrt nakon ciljanja Bcl-X L / Mcl-1 nije izmijenjena (Slika 6e). Indukcija apoptoze potvrđena je obojanjem s aneksinom V-pozitivno / propidijum i demonstriranjem aktivacije kaspaze-3 (slika 6f). Da isključimo da je svaka aktivatorna molekula samo za BH3 relevantna za apoptozu nakon gubitka Bcl-X L / Mcl-1, stvorili smo MEF koji su trostruko deficitarni za Bim, Puma i Bid. Za to je CRISPR / Cas9 (s klasteriranim redovito interspaced kratkim palindromskim ponavljanjima / endonukleaza) korišten za generiranje stanica s nedostatkom ponude na temelju MEF-ova stanica Bim / Puma-knockout. Stanice trostrukog nokauta još uvijek su snažno pretrpjele apoptozu kad su Bcl-X L / Mcl-1 bili ciljani koristeći različite siRNA sekvence (Slika 6g).

Image

Apoptoza inducirana inhibicijom Bcl-X L / Mcl-1 događa se u odsustvu proteina samo za aktivator BH3. ( a ) MEF-manjinski MEF-i su tretirani kontrolnim siRNA-ima ili siRNA-ima koje ciljaju Puma, Bid i Bim istovremeno. razine mRNA izmjerene su 24 sata nakon transfekcije. Prikazivanje podataka znači ± SD od tri neovisna pokusa. ( b ) MEF-manjinski MEF-ovi su transfektirani kontrolnim siRNA-ima ili siRNA-ima koji ciljaju Pumu, Bid i Bim. Četrdeset osam sati nakon transfekcije, stanice su transficirane Bcl- XL ili kontrolnim siRNAs, a stanična smrt mjerena je 24 sata kasnije. Prikazivanje podataka znači ± SD od tri neovisna pokusa. ( c ) MEF-ovi iz Bim / Puma-dvostruko deficitarnih ili WT miševa transficirani su s Bcl- XL i Mcl-1 ili kontrolnim siRNA. Stanična smrt mjerena je 3 dana nakon transfekcije. ( d ) MEF-ovi iz Bim / Puma-dvostruko deficitarnih miševa transfektirani su kontrolnim ili BID-specifičnim siRNA tijekom 3 dana. Zatim su stanice sijane i transficirane s kontrolom, Bcl-XL-, Mcl-1- i Bid-specifične siRNA kao što je naznačeno. Ponuda je kvantificirana imunoblotiranjem 3 dana nakon druge transfekcije. Rezultati su reprezentativni za tri neovisna pokusa. ( e ) Stanična smrt mjerena je u Bim / Puma-dvostruko deficitarnom MEF-u tretiranom kako je opisano u d . Dani su srednji postotak ± SD pozitivnih ćelija iz aneksina V- / propidijum-jodida u tri neovisna pokusa. ( f ) Gornja ploča: reprezentativni histogram BIM / Puma-dvostruko deficitarnih MEF-a tretiranih kao što je opisano u d, naznačujući stanice podvrgnute apoptozi, što pokazuje demonstracija populacije staničnih negativnih / propidijum-jodida negativnih V-pozitivnih Donja ploča: kvantifikacija aktivacije kaspaze-3 imunoblotiranjem. Rezultati su reprezentativni za tri neovisna pokusa. ( g ) MEF-ovi s Bid / Bim / Puma-trostrukim nedostatkom transfektirani su s Bcl-X L - i Mcl-1 specifičnim siRNA-ima ili kontrolnim siRNA-ima. Stanična smrt procijenjena je nakon 48 h. Za Bcl-X L i Mcl-1 korištene su dvije različite siRNA sekvence (siRNA a ili b) u različitim kombinacijama. Umetci pokazuju rezultat odbacivanja ponude pomoću CRISPR / CAS9 na Bim / Puma DKO MEF za generiranje trostrukih KO stanica. ( h ) Primarni humani fibroblasti tretirani su istovremeno sa Bcl-X L -, Mcl-1- i Bak-specifičnim siRNA. Tri dana nakon transfekcije pripremljeni su mitohondriji. Mitohondrije su tretirane s rekombinantnim Baxom (1000 nM) za poticanje otpuštanja citokroma c (Cyt- c ). Oslobađanje citokusa procijenjeno je imunoblotiranjem u supernatantnim (SN) i mitohondrijskim (M) frakcijama. Tom40 (translokacija proteina vanjske mitohondrijske membrane 40) služio je kao kontrola za pripremu mitohondrija. ( i ) Mitohondriji Bax / Bak-dvostruko deficitarnih MEF-a tretirani su rekombinantnim Bax-om. Oslobađanje cita izmjereno je 1000 nM Bax. Prikazana je reprezentativna mrlja dva pokusa. * P ≤ 0, 05

Slika pune veličine

Da bismo dalje isključili uključenost proteina samo za BH3, iskoristili smo treći eksperimentalni model i pripremili mitohondrije iz humanih fibroblasta tretiranih s Bcl- XL -, Mcl-1- i Bak-specifičnom siRNA. Te stanice opstaju zbog nedostatka Baka (slika 2a). Ako su aktivirani samo BH3 proteini u tim stanicama, oni bi se lokalizirali na membrani izolirane mitohondrije i mogli bi aktivirati egzogeno dodan Bax, što dovodi do oslobađanja citohroma c . Kada je aktivni Bim prekomjerno izražen u mitohondrijama s dvostrukom manjkom Bax / Bak, niske razine (oko 50 nM) rekombinantnog Baxa dovoljne su da uzrokuju otpuštanje citohroma c . 18 U mitohondrijama iz Bax / Baka dvostruko deficitarni MEF koji nisu bili manipulirani, visoka razina (1000 nM) rekombinantnog Baxa uzrokovala je oslobađanje citohroma c (slika 6h). Međutim, čak i pri ovoj visokoj koncentraciji, Bax nije doveo do oslobađanja citokroma c iz mitohondrija izoliranih iz humanih fibroblasta tretiranih siRNA koji ciljaju Bcl- XL, Mcl-1 i Bak (Slika 6i). To ukazuje da na mitohondrijama nema aktivnog proteina samo za BH3 koji je mogao dovesti do Bakkove aktivacije, kada su stanice izgubile Bcl-X L i Mcl-1.

Ovi podaci zajedno pokazuju da čak i gubitak svih proteina samo za aktivator BH3 ne utječe na apoptozu induciranu inhibicijom Bcl-X L i Mcl-1. Nadalje, ovo se događa u nedostatku aktivnih bh3 samo proteina u mitohondrijama. To snažno sugerira da proteini samo BH3 nisu uključeni u pokretanje apoptoze nakon gubitka Bcl-X L i Mcl-1 u ovim stanicama.

Rasprava

Naši rezultati pokazuju da uklanjanje dva anti-apoptotička proteina u nekoliko vrsta zloćudnih stanica aktivira Bak i naknadno uzrokuje apoptozu, za koju se činilo da ne zahtijevaju samo BH3 proteine. Ovo ukazuje da se Bak stvarno može automatski aktivirati kada se ta inhibicija ukloni. Ovi rezultati mogu objasniti zašto stanice eksprimiraju i Baxa i Baka, unatoč prividnoj biološkoj redundantnosti.

Moguće je da se aktiviranje Baxa bolje razumije nego aktiviranje Baka. Bax se može izravno povezati BH3 domenama Bim i Bid. 8 Bax je normalno neaktivan u citosolu, ali vrlo se vjerojatno može aktivirati izravnom interakcijom s BH3 domenom samo BH3 proteina. Samo BH3 proteini (osim Loših) repno su usidreni u vanjskoj mitohondrijskoj membrani. 7, 18 Izgleda vjerojatni model da se Bax može aktivirati samo proteinima BH3 jer se difuzno prolazi kroz mitohondrijsku membranu, gdje ubacuje i pokreće oslobađanje citokroma c .

Međutim, možda nije prikladno pretpostaviti isto za Baka. Bak je u odsustvu apoptoze koja je već umetnuta u OMM. Iako se Bak u principu može aktivirati samo proteinima BH3 i to se može dogoditi izravnim vezanjem, zahtjevi za aktivaciju Baxa u odnosu na Bak, s njihovim različitim prostornim ograničenjima, vjerojatno su različiti. Nadalje, Bak u principu može vezati Bcl- XL i Mcl-1, a sva tri proteina su u mitohondrijima; Stoga se čini vjerojatnim da postoji neko vezivanje u normalnoj, ne-apoptotičnoj stanici.

Suprotno tome, model neizravne aktivacije kontra-intuitivan je za Bax, s njegovom primarnom citosolnom lokalizacijom: iako potencijalno vezivanje za anti-apoptotičke Bcl-2-proteine ​​za Bax može biti sugestivno, 11 Bax je očito barem pretežno citosolni. U skladu s tim, studije raseljavanja eksperimentalno su se usredotočile na Baka i ekstrapolirale su nalaze na Baxa. Postoje jasni dokazi da aktiviranje Baxa može uključivati ​​mjeru pomaka ili neizravnu aktivaciju. To se, međutim, vidi u situacijama u kojima je apoptoza pokrenuta, ali potom blokirana anti-apoptotičkim Bcl-2 proteinima. Kako je razrađeno pomoću "objedinjenog modela", inhibicija aktivnog Baxa i Baka važna je funkcija proteina sličnih Bcl-2.

Doista, ovaj način aktivacije Baxa može biti važna razlika između tumorskih stanica i nemalignih stanica. U mnogim slučajevima razvoj tumora stvara potrebu za izmjenama koje pomažu transformiranim stanicama da izbjegnu obrambene mehanizme organizma domaćina, poput apoptoze. 19 Prije smo primijetili da se u tumorskim stanicama gubi ekspresijski profil anti-apoptoptičnih Bcl-2 proteina specifičnih za staničnu lozu, što je povezano s povećanom ovisnosti tumorskih stanica o tim proteinima. 15 U usporedbi sa stanicama karcinoma, studije koje su ispitivale anti-apoptotičke članove Bcl-2 u nemalnim stanicama manje su sveobuhvatne.

U studiji stanica karcinoma, gdje je korištena mala biblioteka molekula za identifikaciju spojeva koji inhibiraju Mcl-1, Bcl-X L je identificiran kao jedini marker koji predviđa osjetljivost na spojeve koji inhibiraju Mcl-1, a ti mali molekuli su putem Baka inducirali apoptozu a ne Bax. 20 U ne-transformiranim stanicama koristili smo ovdje samo istodobno uklanjanje Bcl-X L i Mcl-1, ali ne i samostalno (ili u kombinaciji s bilo kojim drugim proteinima sličnim Bcl-2) izazvano apoptozom. To smo opazili u nekoliko vrsta zloćudnih ćelija, što ukazuje na češću regulaciju preživljavanja. Ova razlika između stanica raka i normalnih stanica može se protumačiti kao pokazatelj unaprijed aktiviranog Bcl-2 sustava u stanicama tumora. Kod ostalih tipova stanica ova ovisnost može se opet razlikovati. Mcl-1 je kritično potreban za razvoj i održavanje mnogih stanica hematopoetskog sustava i dovoljno je oduzeti Mcl-1 u zrelim limfocitima da inducira apoptozu. 21

Zajedno, naša studija pruža dokaze da se Bak može aktivirati neovisno o bh3 proteinima samo u malignim stanicama. Stoga se čini da se Bak može automatski aktivirati, a to je možda glavni mehanizam njegove aktivacije. Bax i Bak u mnogim situacijama mogu imati istu aktivnost i zamjenjuju se jedni drugima, a ne čini se vjerojatnim objašnjenjem zašto imamo dva efektorska proteina koja djeluju na isti način. Drugačiji način aktivacije s Bax-om koji zahtijeva aktivaciju preko proteina samo za BH3 i Bak-ovim automatskim aktiviranjem kad se ukloni inhibicija čini se da pruža razlog za oboje.

Materijali i metode

Reagensi i antitijela

Antitijelo protiv Bcl-2 (Ab-1) kupljeno je od tvrtke Merck Biosciences (Darmstadt, Njemačka). Anti-Bcl-X L, anti-Bcl-w, anti-Bid, anti-Bim (C34C5), anti-Bak, anti-kaspaza-3, anti-kaspaza-8 (1C12), anti-kaspaza-9 i HRP -konjugirana sekundarna antitijela dobivena su iz New England Biolabs (Berlin, Njemačka). Antitijelo Mc-1 (22) bilo je iz BD Bioscience (Heidelberg, Njemačka), anti-Bax (2D2) bilo je iz Santa Cruz Biotechnology (Heidelberg, Njemačka), a anti-citohrom c (klon 7H8.2C12) kupljen je od BD Bioznanosti (Heidelberg, Njemačka). Antitijela protiv p- aktina (AC-15) i anti- a -tubulina (DM1A) dobivena su iz Sigma-Aldrich (München, Njemačka). Bax-aktivacija je mjerena protočnom citometrijom bojenjem s antitijelom specifičnim za konformaciju aktiviranog Bax-a (klon 3; BD Pharmingen, Heidelberg, Njemačka). PCR primeri i siRNA kupljeni su od Eurofins MWG Operon (Ebersberg, Njemačka).

siRNA

siRNA su dizajnirani kako je prethodno opisano. 22 Slijed specifičnih siRNA bio je A1 (čovjek): GGAAGAAUUGUAACCAUAU, loš (čovjek): GGATGAGTGACGAGTTTGT, Bak (čovjek): GCTTCGTGGTCGACTTCAT, Bak (miš): ACACAGAGTTCCAGAATTTT, Bax (GTC) GCC (GACTGGGGGGCGGGCGGGGCGTGGCGGGGCGTGGGGGCGGGGGGGGGGGGCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT) 2 (čovjek): GGGAGAUAGUGAUGAAGUA, Bcl-w (čovjek): GGCAGACUUUGUAGGUUAU, Bcl-X L (čovjek): GGAACUCUAUGGGAACAAU, Bcl-X L (miš): GCGTGGAAAGCGTGTTACACAA (Bcl-X LT (miš)) Bim (čovjek): GCAACCTTCTGATGTAAGT, Bim (miš): GGAGACGAGTTCAACGAAA, Mcl-1 (čovjek): GGCAGUCGCUGGAGAUUAU, Mcl-1 (miš): GGGACTGGCTTGTCAAACA, Puma (miša): Puma (miš) Prikazani su dijelovi od 19 nt koji odgovaraju osjetilnom lancu ciljane mRNA. Redoslijed ne-prigušivanja kontrolne siRNA (Ctrl) bio je GCGCAUUCCAGCUUACGUA.

Generiranje Bim, Puma, Bid trostruki knockout MEF pomoću CRISPR / Cas9

Ponuda je bila posebno usmjerena u BIM / Puma dvostruko deficitarni MEF pomoću dva vektorskog CRISPR / CAS9 sustava koji je ljubazno pružio dr. Veit Hornung (Institut za molekularnu medicinu, Sveučilišna bolnica Bonn, Njemačka) prolaznom transfekcijom i naknadnim odabirom. Učinkovitost je testirana primjenom antitijela protiv Bida.

Stanična kultura

Primarni ljudski fibroblasti i keratinociti izolirani su iz neonatalnih ljudskih prepucija. Kultiviranje stanica bilo je prethodno opisano. 23 Ljudske mikrovavaskularne endotelne stanice i besmrtni embrionalni fibroblasti (MEF) uzgajani su u DMEM (Dulbeccovom modificiranom mediju Eagle) uz dodatak 10% FCS (fetalni teleći serum).

Postupci transfekcije

Transakcije siRNA izvedene su u posudama sa 6 jažica u zapremini od 1 ml koristeći lipofektamin RNAiMAX (Invitrogen, Darmstadt, Njemačka) prema protokolu proizvođača. Za inhibiciju jednog gena korišten je 20 nM siRNA zajedno s 1, 25 µl lipofektamin RNAiMAX. Za eksperimente dvostruke ili trostruke inhibicije upotrebljena je svaka specifična siRNA u koncentraciji od 20 nM. Količina kontrolne siRNA je prilagođena ukupnoj količini specifičnih siRNA korištenih u eksperimentu kao što je prikazano na slikama. U pokusima dvostruke inhibicije 40 nM specifičnih siRNA ili 40 nM kontrolnih siRNA, u pokusima s trostrukom inhibicijom upotrijebljeno je 60 nM siRNA ili 60 nM kontrolne siRNA zajedno s 2 μl lipofektamina RNAiMAX. Plazmidi su transficirani u 1 µg / ml s 3 µl FuGENE 6 (Roche) prema protokolu proizvođača.

Kvantifikacija održivih stanica

Životne stanice s netaknutim metabolizmom identificirane su njihovom sposobnošću da smanje resazurin koji propušta stanicu do fluorescentnog resorufina. Medij je zamijenjen sa 750 μl kultivacijskog medija i 150 μl CellTiter-Blue reagensa (CellTiter-Blue Cell Viability Test; Promega, Mannheim, Njemačka). Nakon 1 h inkubacije na 37 ° C, izmjerena je fluorescencija.

Kvantifikacija apoptotskih stanica i stanična smrt

Adherentne i supernatantne stanice analizirane su bojenjem s FITC-om označenim Annexin V (Roche, Mannheim, Njemačka) i propidijevim jodidom (Sigma-Aldrich), kao što je prethodno opisano. 24 ćelije su analizirane pomoću analize sortiranja fluorescencije aktivirane pomoću CellQuest softvera (BD Bioscience).

Ekstrakcija i kvantifikacija RNA

Ukupna RNA ekstrahirana je iz stanica koristeći QIAzol Lysis reagens (Qiagen, Hilden, Njemačka) kako je opisao proizvođač i analizirao kvantitativnom RT-PCR. Postupci obrnute transkripcije i kvantifikacije pomoću LightCycler TaqMan Master Kit (Roche) zajedno s univerzalnim sustavom biblioteke sonde (Roche) su prethodno opisani. 24 Relativna ekspresija gena izražena je kao omjer razine ekspresije gena od interesa za onu RNA hipoksantin-fosforibosiltransferaze utvrđene na istom uzorku.

Priprema proteina i analiza imunoblota

Adherentne i supernatantne stanice su lizirane u puferu koji sadrži 50 mM Tris, pH 7, 4, 0, 25 M NaCl, 1 mM EDTA, 0, 1% Triton X-100, inhibitori fosfataze (PhosSTOP, Roche) i inhibitori proteaze (Complete, Mini, bez EDTA; Roche). Gel elektroforeza, blotting i otkrivanje proteina provedena je korištenjem Xcell SureLock Mini-Cell uređaja (Invitrogen) kao što je prethodno opisano. 24 Nivoi p- aktina ili α -tubulina proteina analizirani su kao kontrola za stalno punjenje i prijenos.

Izolacija i liječenje mitohondrija

Mitohondrije su izolirane staničnim homogenizatorom (Isobiotec, Njemačka), prethodno ohlađenim na ledu, zajedno s umetnutom kuglicom volframovog karbida od 10 mm. Homogenizator je uravnotežen sa izolacijskim puferom (PBS je nadopunjen koktelom inhibitora proteaze za stanicu sisavaca (Sigma-Aldrich)). Ukupno 5 × 106 stanica stavljeno je resuspendirano u 1 ml izolacijskog pufera, a stanične membrane su propuštene prolaskom suspenzije stanica tri puta kroz sustav. Homogenat se dobije ispiranjem jednom s 1 ml izolacijskog pufera i centrifugiranjem (800 × g , 5 min na 4 ° C) kako bi se uklonili stanični ostaci i jezgre. Supernatant je centrifugiran na 9000 × g (10 min pri 4 ° C), a pelet koji sadrži mitohondrije resuspendiran u 50 μl izolacijskog pufera. Ukupno 30 μg uzorka mitohondrija centrifugira se (9000 × g , 10 min na 4 ° C) i resuspendira u 20 μl KCl pufera (10 mM HEPES pH 7, 4, 125 mM KCl, 4 mM MgCl2, 5 mM KH2P04 i 0, 5 mM EGTA), dopunjeno Baxom kako je naznačeno u odgovarajućim eksperimentalnim uvjetima. Mitohondrije su se inkubirali 30 minuta na 30 ° C, a mitohondrije su peletirane na 9000 × g tokom 10 minuta na 4 ° C. Supernatant je sakupljen i peletirani mitohondriji su isprani u 150 μl KCl pufera i resuspendirani u 20 μl KCl pufera. Frakcije supernatanta i mitohondrije analizirane su imunoblotingom.

statistika

Za statističku analizu korišten je dvostruki Studentov t- test za procjenu važnosti srednjih razlika. Razlike su smatrane značajnim kod P- vrijednosti 0, 05 ili manje (naznačeno na slikama (ns, nije značajno; P > 0, 05)).

Glosar

Bax

X-protein povezan s Bcl-2

Bak

Bcl-2 homologni antagonist / ubojica

Bcl-X L

B-stanični limfom-izuzetno velik

Bcl-2

B-stanični limfom 2

Bcl-w

Bcl-2 sličan protein 2

MCL-1

slijed leukemije mijeloidnih stanica 1

A1

Bcl-2 srodni protein A1

BIM

Bcl-2 posrednik stanične smrti

Ponuda

BH3-agonist smrti domene interakcije

Puma

p53-regulirani modulator apoptoze

opasnostima

Protein 1 izazvan fobol-12-miristat-13-acetatom

Loše

Promotor smrti povezan s Bcl-2

BMF

Bcl-2-modificirajući faktor

Bik

Ubojica koji djeluje na Bcl-2

kn

aktivator apoptoze hara-kiri

CRISPR

grupirani redovito isprekidani kratki palindromski ponavljanici

Cas9

endonukleazama