Snažni i selektivni mali molekuli mcl-1 inhibitora pokazuju aktivnost ubijanja stanica karcinoma kao jedno sredstvo i u kombinaciji s abt-263 (navitoclax) | stanična smrt i bolest

Snažni i selektivni mali molekuli mcl-1 inhibitora pokazuju aktivnost ubijanja stanica karcinoma kao jedno sredstvo i u kombinaciji s abt-263 (navitoclax) | stanična smrt i bolest

Anonim

teme

  • apoptoza
  • Kombinirana terapija lijekovima
  • Ciljane terapije

Sažetak

Anti-apoptotički protein MCL-1 ključni je regulator preživljavanja stanica karcinoma i poznati faktor otpornosti na male molekule obiteljskih inhibitora BCL-2, poput ABT-263 (navitoclax), što ga čini atraktivnom terapijskom metom. Međutim, direktno inhibiranje ovog cilja zahtijeva prekid interakcije bjelančevina i proteina visokog afiniteta, pa se zato pokazalo iznimno izazovnim dizajniranjem malih molekula dovoljno snažnih da inhibiraju MCL-1 u stanicama. Ovdje ćemo opisati niz indola-2-karboksilnih kiselina, na primjer primjera spoja A-1210477, koji se veže na MCL-1 selektivno i s dovoljno afiniteta da poremeti MCL-1-BIM komplekse u živim stanicama. A-1210477 potiče obilježja unutarnje apoptoze i pokazuje ubojstvo pojedinačnih uzročnika multiplog mijeloma i ne-sitnoćelijskih staničnih karcinoma pluća za koje je dokazano da su MCL-1 ovisni o eksperimentima spašavanja BH3 ili spašavanjem siRNA. Kao što je predviđeno, A-1210477 sinergira s navitoclax inhibitorom BCL-2 / BCL-X L da ubije razne stanične stanice raka. Ovaj rad predstavlja prvi opis malih molekularnih inhibitora MCL-1 s dovoljno potencijala da induciraju jasnu staničnu aktivnost na cilj. Također pokazuje korisnost ovih molekula kao kemijskog alata za seciranje osnovne biologije MCL-1 i obećanje inhibitora MCL-1 s malim molekulama kao potencijalnih terapija za liječenje raka.

Glavni

Anti-apoptotički proteini poput BCL-2, BCL-X L i MCL-1 održavaju preživljavanje stanica vezanjem i sekvenciranjem njihovih pro-apoptotičkih kolega, kao što su BAK, BAX, ili samo proteini BCL-2 homologije 3 (BH3). BAD i BIM. 1, 2, 3 Budući da stanice raka moraju preživjeti usred različitih stresnih utjecaja na okoliš, one često izražavaju visoke bazalne razine ovih obiteljskih kompleksa BCL-2 i opisano je da su "pripravljene za smrt". 4 Tijekom posljednja dva desetljeća, timovi bazičnih i translacijskih znanstvenika radili su na stvaranju inhibitora male molekule tih interakcija protein-protein, s ciljem pokretanja stanica karcinoma da pokrenu apoptozu.

Iako se drogiranje tih interakcija pokazalo posebno izazovnim, intenzivni napori koji se temelje na strukturi omogućili su dizajn snažnih i stanično aktivnih inhibitora BCL-2 obitelji. ABT-737 bio je među prvim opisanim molekulama, a 5 je nakon toga uslijedila oralno bioraspoloživa molekula, ABT-263 (navitoklaks). 6 Obje molekule oponašaju BAD, s visokim afinitetom za BCL-2, BCL-X L i BCL-W, a obje molekule su predklinički pokazale impresivno antiumorsko djelovanje. 7, 8 Iako je navitoklaks također pokazao obećavajuće znakove kliničke aktivnosti, njegov je razvoj kompliciran trombocitopenijom koja ograničava dozu, rezultat inhibicije BCL-X L. 9, 10 To je potaknulo razvoj ABT-199 / GDC-0199 (venetoklaks), BCL-2-selektivnog inhibitora koji održava učinkovitost protiv tumora uz štednju trombocita. 11 Generirani su i selektivni inhibitori BCL-X L 12, 13, 14, 15, a najsnažnije molekule A-1155463 i A-1331852 pokazuju značajne anti-tumorske učinke same ili u kombinaciji s kemoterapeuticima (predani rukopis).

Nijedan prethodno opisani inhibitor BCL-2 ne može inhibirati MCL-1, i stoga nije iznenađujuće što se ovaj protein pojavio kao potencijalni faktor otpornosti na ove agense. 16, 17, 18, 19 MCL-1 je također uključen u posredovanje otpornosti na različita najčešće korištena kemoterapijska sredstva, 20, 21, 22 i tako stvaranje malih molekula sposobnih inhibirati MCL-1 predstavlja atraktivan pristup za zaobilaženje otpornosti na lijekove, MCL-1 je sama sebi uvjerljiva meta raka koja je uključena u posredovanju preživljavanja više tipova tumora. 23 Lokalitet gena MCL1 pojačan je u različitim vrstama tumora, uključujući karcinom dojke i ne-sitnoćelijski rak pluća (NSCLC), a 24 i MCL-1 protein pokazali su da posreduju u preživljavanju na modelima multiplog mijeloma, 25, 26 akutna mijeloidna leukemija 27 i NSCLC 28, 29 i limfomi uzrokovani MYC-om. 30

Opisani su različiti pristupi inhibicije MCL-1, uključujući upotrebu BH3 peptida 31, 32, 33, 34 i malih molekula 35, 36, 37, 38, 39 koji direktno vežu MCL-1 ili posredno inhibiraju njegovu ekspresiju. 18, 40, 41, 42 Od prijavljenih izravnih inhibitora male molekule nijedan ne posjeduje afinitet MCL-1 unutar raspona za koji bi se moglo očekivati ​​da daje ciljane stanične učinke. Indirektni inhibitori MCL-1 uključuju inhibitore kinaze ovisne o ciklinu, kao što su roskovitin, flavopiridol, seliciklib, dinaciklib i SNS-032, koji inhibiraju fosforilaciju C-terminalne domene RNA polimeraze 2 i produženje transkripata, uključujući MCL1 . 40, 41, 42 Zbog kratkog (otprilike 30 minuta) poluživota, protein MCL-1 brzo se eliminira nakon tretiranja flavopiridolom ili dinaciklibom. 40 Antraciklini, poput daunorubicina, također su pokazali da suzbijaju MCL-1 ekspresiju. 43 Moguća odgovornost neizravnih inhibitora MCL-1 je da oni također smanjuju ekspresiju brojnih drugih kratkotrajnih proteina, čineći ih manje selektivnim i potencijalno toksičnijim.

Ovdje predstavljamo niz izravnih, snažnih i selektivnih MCL-1 inhibitora koji pokazuju jasno ciljanu staničnu aktivnost, remetijući MCL-1-BIM proteinske komplekse i izaziva apoptozu u staničnim linijama karcinoma za koje se pokazalo da se oslanjaju na MCL-1 za preživljavanje. Kao što se i očekivalo, ove molekule senzibiliziraju različite tumorske stanične linije na navitoklaks inhibitora BCL-2 / BCL-XL. Prema našem saznanju, te molekule predstavljaju prve izravne inhibitore MCL-1 s potencijom i svojstvima potrebnim da inhibiraju MCL-1 u živim stanicama.

Rezultati

A-1210477 veže se za MCL-1 s visokim afinitetom i inducira porast proteina MCL-1 u stanicama

Nedavno smo opisali sintezu inhibitora malih molekula MCL-1 razrađenih iz jezgre indola-2-karboksilne kiseline. 44 Iako su molekule s istom jezgrom također opisane od strane druge skupine, 38 tih molekula bilo je manje razrađeno, imale su niži afinitet ( K i > 0, 050 µM ) za MCL-1, te nisu zabilježene da pokazuju staničnu aktivnost. A-1210477 (dopunska slika S1) posebno je snažno vezivo MCL-1 ( K i = 0, 000454 µM u vremenski razlučenim fluorescentnim rezonantnim energetskim prijenosima (TR-FRET) vezanjem), što predstavlja poboljšanje afiniteta za najmanje dva redoslijedom veličine iznad gore spomenutih molekula, ali je puno slabije vezivo BCL-2 ( K i = 0, 132 μM ) i BCL-X L ( K i > 0, 660 μM ). A-1155905, A-1208746 i A-1248767 su usko povezani analozi sa sličnim profilima afiniteta (dodatna slika S1 i dodatna tablica S1).

Kao prvi test potencijalne stanične aktivnosti ovih molekula, procijenili smo njihovu sposobnost da se nadmeću s B3 proteinom samo za BH3 za vezanje na MCL-1 u stanicama H929 koristeći testove ko-imunoprecipitacije. Četiri sata liječenja s 10 µM A-1210477 bilo je dovoljno za smanjenje količine BIM ko-imunoprecipitiranog s MCL-1 antitijelom, iako se značajno više MCL-1 povuklo iz A-1210477 tretiranih H929 stanica u odnosu na nosač- tretirane kontrole (Slika 1a). Istražujući potonji učinak, otkrili smo da je A-1210477 pokrenuo povišenje MCL-1 u različitim staničnim linijama karcinoma, uključujući staničnu liniju karcinoma dojke HCC-1806 (slika 1b). Za razliku od inhibitora proteasoma bortezomib, A-1210477 nije imao utjecaja na razine proteina NOXA koji veže MCL-1. U istom vremenskom okviru nije opaženo odgovarajuće povećanje MCL1 mRNA, što ukazuje da to nije bio transkripcijski odgovor. Analog A-1210477 A-1248767 izazvao je slična povećanja ovisna o koncentraciji u proteinu MCL-1, ali ne i u BCL-X L (Slika 1c). Povećanje proteina MCL-1 može se primijetiti u koncentracijama nižim od 0, 5 μM za A-1210477 i A-1248767, koje imaju konstante afiniteta MCL-1 u rasponu od 0, 0004–0, 0005 μM (Slike 1b i c; Dodatna tablica S1), dok manje razrađeni spojevi poput A-954248 (K i = 0, 348 µM) i A-962653 (K i = 0, 130 µM) nisu imali utjecaja na razine MCL-1 do koncentracija do 20 μM (Slika 1c). Intrigantno je pokazano da egzogena ekspresija poznatih proteina koji vežu MCL-1, kao što su PUMA i BIM2A, uzrokuje slična povišenja MCL-1 proteina, vjerojatno isključujući vezanje proteina samo za BH3, kao što su NOXA i MULE, koji su poznati za posredovanje sveprisutnosti i proteasomske degradacije MCL-1. 45, 46 Dakle, ovdje prikazani podaci pružaju prvu indikaciju da ove male molekule djeluju kao mimetici BH3 koji izravno ciljaju MCL-1.

Image

Razina MCL-1 povišena je u stanicama raka nakon liječenja malim molekulama koje vežu MCL-1. ( a ) H929 stanice s multiplim mijelomom tretirane su 4 sata s 10 µM A-1210477 prije imunoprecipitacije MCL-1. Imunoprecipitati su zatim analizirani imunoblotingom za MCL-1 i pridruženi BIM. Kontrolni H929 lizat je pokrenut u traci 1, a imunoprecipitacija s nespecifičnim antitijelom (Ig) pokrenuta je u traci 2. Položaj markera molekulske mase (naveden u kiloDaltonima) naveden je s lijeve strane. ( b ) HCC-1806 stanice karcinoma dojke inkubiraju se s povećanjem koncentracija A-1210477 (0, 1, 0, 5, 1, 5, 10, 15 ili 20 µM ) ili bortezomiba (2, 10 ili 50 nM) tijekom 8 sati prije procjene razine MCL-1 i NOXA imunoblotiranjem. P- Aktin je ispitivan kao kontrola punjenja proteina. Donji graf prikazuje kvantifikaciju reverzne transkriptaze-PCR MCL1 mRNA iz HCC-1806 stanica tretiranih 8 h sa sličnim koncentracijama A-1210477. ( c ) HCC-1806 stanice inkubiraju se s povećanim koncentracijama (0, 1, 0, 5, 1, 5, 10 i 20 μM) A-954248, A-962653 ili A-1248767 24 sata prije procjene MCL-1 i Razine BCL-X L imunoblotingom. P- Aktin je ispitivan kao kontrola punjenja proteina

Slika pune veličine

A-1210477 prekida MCL-1-BIM komplekse u živim stanicama

Promatranje da su se A-1210477 i A-1248767 u povišenom nivou MCL-1 ponašali slično bjelančevinama samo za BH3, ukazalo je da su ti spojevi propusni za stanicu i direktno se vežu za MCL-1. Da bismo to potvrdili, implementirali smo razne ortogonalne pristupe za mjerenje učinaka ovih spojeva na stanične MCL-1-BIM komplekse. Prvo smo upotrijebili kombinirani ko-imunoprecipitacijski-enzimski povezani imunosorbentni protokol (ELISA), počevši od imunoprecipitacije i na uzorku MCL-1 i njegovih partnera koji se vežu na ploči, nakon čega je ispitivano BIM antitijelom i sekundarnim antitijelom koje omogućava elektrokemiluminescence- na temelju kvantifikacije MCL-1-BIM kompleksa (vidi Materijali i metode). A-1210477 uzrokovao je smanjenje količine BIM ko-imunoprecipitirane s MCL-1, s IC50 u rasponu niskog µM (slika 2a). Primijetili smo sličnu inhibiciju MCL-1-NOXA interakcije ovisne o nedavno opisanom dvo-hibridnom sustavu sisavaca (slika 2b) koji omogućuje kvantificiranje interakcija bjelančevina i proteina BCL-2 u živim stanicama. 11 A-1210477 inhibira interakcije MCL-1-NOXA s IC50 od približno 1 μM, bez utjecaja na BCL-2-BIM ili BCL-XL-BCL-XS interakcije izmjerene u istoj staničnoj pozadini (slika 2b). Ostali analozi, uključujući A-1155905, pokazali su sličnu funkcionalnu selektivnost za MCL-1 (dopunska slika S2).

Image

MCL-1 inhibitor A-1210477 uništava MCL-1-BIM komplekse. ( a ) Stanice H929 su tretirane s povećanjem koncentracije A-1210477 4 h. MCL-1 protutijelo je upotrijebljeno za hvatanje MCL-1 i pripadajućeg BIM-a, što je otkriveno primjenom MescheScale elektrokemiluminescentne analize. Svi podaci predstavljaju sredinu trostrukih eksperimenata, s trakama pogrešaka koje ukazuju na SD ( b ) Kvantitativno mjerenje interakcija bjelančevina i proteina pomoću dvo-hibridnog testa na sisavaca na bazi luciferaze. Stanice HeLa stabilno transfektirane s GAL4 pokretačem luciferaze izvjestitelj i eksprimiraju uparene GAL4DBD – MCL-1: VP16AD – NOXA, VP16AD – BCL-2: GAL4DBD – BIM ili GAL4DBD – BCL-X L : VP16AD – BCL-X S fuzijski proteini bili su inkubira se s povećanjem koncentracije A-1210477 kroz 24 sata. Svi podaci predstavljaju sredstvo trostrukih eksperimenata, s trakama pogrešaka koje ukazuju na S.Ds.

Slika pune veličine

Kako bismo dalje isključili potencijalne artefakte povezane s deterdžentima za lizate koji mogu utjecati na interakcije između proteina obitelji BCL-2, 47 koristili smo nedavno opisanu metodu snimanja u stvarnom vremenu kako bismo procijenili učinke na obiteljske komplekse BCL-2 u živim stanicama. 48 Ukratko, interaktivni parovi proteina iz porodice BCL-2 izraženi su kao fluorescentni fuzijski proteini na stehiometrijskim razinama iz bicistronskog ekspresijskog modula integriranog u jedno mjesto genoma u stanicama T-REx-293. U bazalnim uvjetima oba proteina se lokaliziraju prvenstveno u mitohondrijima, gdje anti-apoptotički proteini (pojačani zeleni fluorescentni protein (eGFP) -BCL-2, eGFP-BCL-X L ili eGFP-MCL-1 (3B)) pro-apoptotičke palete (mCherry-BAD ili mCherry-BIM S (2A) ΔC, pri čemu je potonji specifično vezivo MCL-1 48, 49 ). Prekid ovih kompleksa može se pratiti mjerenjem količine proteina koji je označen mCherry-om samo BH3 lokaliziranog specifično na mitohondrije. Ako se proteinski kompleksi poremete mimetikom male molekule BH3, signal mCherry-a povezan s mitohondrijama opada kako se fuzioni protein samo za BH3 preraspodjeljuje u citosol. Kao što je prethodno pokazano, 48 BCL-2 / BCL- XL inhibitor ABT-737 inducirao je preraspodjelu mCherry-BAD povezanog s BCL-2 ili BCL-X L (Slike 3a i d). Međutim, ABT-737 nije utjecao na raspodjelu BIM S (2A) ΔC u stanicama koje eksprimiraju MCL-1 (3B) (slike 3a, b i d). Suprotno tome, A-1210477 nije imao utjecaja na BCL-2-BAD ili BCL-X L- BAD komplekse, već je inducirao ovisnu o dozi preraspodjelu BIM S (2A) ΔC na citosol u roku od nekoliko minuta liječenja (slike 3a-c; dopunska slika S3). Taj je učinak ovisio o koncentraciji i mogao se primijetiti u koncentracijama nižim od 1 μM (slika 3b). Stoga podaci dobiveni u četiri odvojena ispitivanja pokazuju da A-1210477 i njegovi srodni analozi mogu prodrijeti do živih stanica i vežu se na MCL-1 selektivno i s dovoljno afiniteta da se natječu s proteinima samo za BH3.

Image

A-1210477 inhibira MCL-1-BIM komplekse u živim stanicama. ( a ) T-REx-293 stanice stabilno eksprimiraju eGFP-MCL-1 (3B) i mCherry-BIM S (2A) ΔC, eGFP-BCL-2 i mCherry-BAD, ili eGFP-BCL-X L i mCherry-BAD obrađeni su s 10 μM ABT-737, A-1210477 ili dimetil sulfoksidom (DMSO) i obrađivani su 300 minuta. Spojevi su dodani nakon stjecanja prve slike. Smanjenje količine proteina mCherry-BH3 lokaliziranog u mitohondrijima kvantificirano je kao funkcija vremena kao što je opisano u Materijalima i postupcima, normalizirano na DMSO kontrolu i uklopljeno u jedno eksponencijalno raspadanje. Svaka podatkovna točka predstavlja srednju promjenu intenziteta izračunatu iz 10 vidnih polja, s trakama pogrešaka koje ukazuju na SEM ( b ) T-REx-293 stanice stabilno izražene eGFP-MCL-1 (3B) i mCherry-BIM S (2A) ΔC tretirane su s 50 µM ABT-737 ili povećanjem koncentracije (1–25 µM) A-1210477 100 min. Smanjenje količine mCherry-BIM S (2A) ΔC lokalizirano na mitohondrije kvantificirano je kao na ploči ( a ). ( c ) Reprezentativne fluorescentne mikroskopske slike T-REx-293 stanica koje stabilno eksprimiraju eGFP-BCL-2 obitelj i međusobno djeluju mCherry-BH3-samo proteine ​​prije i nakon 300 min tretmana s 10 µM A-1210477 ili ( d ) ABT- 737. Slike u sivim tonovima prikazuju samo mCherry-fuzijske proteine, koji su bili pseudo obojeni crveno u prekrivanju s eGFP-fuzionim proteinima (pseudo obojeno zeleno). Linija skale predstavlja 25 µm

Slika pune veličine

A-1210477 i srodni analozi potiču obilježja apoptoze u staničnoj liniji karcinoma ovisnog o MCL-1

Da bismo olakšali procjenu A-1210477 i njegovih srodnih analoga indola-2-karboksilne kiseline, pokušali smo identificirati stanične linije ovisne o MCL-1 za koje bi se moglo predvidjeti da podležu apoptozi kao odgovor na ta sredstva. Započeli smo s procjenom više staničnih linija mijeloma, za koje se navodi da se za preživljavanje oslanjaju na MCL-1. 25, 26 Pomoću BH3 profiliranja, peptidne metode koja se intenzivno koristi za utvrđivanje ovisnosti o BCL-2, 50 otkrili smo da stanična linija H929 ima jasan profil ovisan o MCL-1. Citokrom c je oslobođen iz mitohondrija permealiziranih H929 stanica liječenih peptidom BIM2A, koji ima selektivni afinitet za MCL-1, 49, ali ne i BAD peptid, koji cilja BCL-2, BCL-X L i BCL-W (slika 4a ). Kada su netaknute stanice H929 tretirane s analogom A-1210477 A-1208746, opažen je citokrom c u citosolnim frakcijama unutar 4 h pri koncentraciji nižim od 3 μM (slika 4a), što ukazuje da ovaj spoj može pokrenuti apoptozu u MCL-1 -zavisne stanice. Kao što se očekivalo, A-1155905, A-1208746 i A-1210477 ubili su stanice H929 s IC50 vrijednostima u rasponu niskog µ M, a da nisu utjecali na RS4; 11 staničnu liniju (slika 4b), što je poznato osloniti se na BCL-2 za opstanak. 11, 51 Ovi podaci pokazuju da ti spojevi selektivno ubijaju stanične linije ovisne o MCL-1.

Image

Indole-2-karboksilne kiseline induciraju obilježja apoptoze u staničnoj liniji karcinoma H929 ovisnoj o MCL-1. ( a ) Digitoninske permeabilizirane stanice H929 tretirane su s 10 µM BH3 peptida 4 sata, a netaknute stanice H929 inkubirane su 4 sata s povećanjem koncentracije (0, 1–10 µM) A-1208746 prije procjene razine citokroma c pušten u citosol. ( b ) H929 i RS4; 11 stanica se inkubiraju s povećanjem koncentracije inhibitora MCL-1 ili BCL-2-selektivnog inhibitora ABT-199 (venetoklaks) 48 sati prije nego što se utvrdi vitalnost stanica. IC50 s ubijanjem stanica iscrtani su sa svakom vrijednošću koja predstavlja sredinu tri odvojena pokusa. Stupci pogrešaka predstavljaju stanice SEM ( c ) H929 inkubirane su s povećanom koncentracijom MCL-1 inhibitora u prisutnosti ili odsutnosti inhibitora pan-kaspaze QVD (100 µM) 4 sata prije procjene aktivacije kaspaze-3 / -7, polarizacija mitohondrijske membrane i izloženost fosfatidilserinu. Podaci predstavljaju sredinu trostrukih eksperimenata, s trakama pogrešaka koje ukazuju na SEM

Slika pune veličine

Kako bismo potvrdili da ovi spojevi djeluju mehanizmom, izveli smo niz ispitivanja namijenjenih procjeni uzastopnih događaja koji se događaju tijekom aktivacije svojstva svojstva apoptoze. A-1155905, A-1208746, A-1210477 i A-1248767 inducirali su obilježja apoptoze u MCL-1 ovisnoj staničnoj liniji H929, uključujući depolarizaciju mitohondrijske membrane, aktivaciju kaspaze-3 / -7 i eksternalizaciju fosfatidilserina na staničnoj površini (slika 4c). Prethodna obrada inhibitorom pan-kaspaze QVD inhibira eksternalizaciju fosfatidilserina, što dalje ukazuje da stanična smrt inducirana ovim spojevima ovisi o kaspazi i nastaje apoptozom. Nadalje, ovi spojevi nisu ubili mišje embrionalne fibroblaste kojima nedostaju efekti proteina apoptoze Bak i Bax (dopunska slika S4), što ukazuje da ne uništavaju stanice bez diskriminacije ne-apoptotičkim mehanizmom.

Dalje smo ispitali učinke ovih molekula u izboru čvrstih tumorskih staničnih linija za koje se izvješće da su ovisni o MCL-1 za preživljavanje, uključujući NSCLC stanične linije H2110 i H23. 24, 29 pokusa spašavanja siRNA (slike 5a i c) i BH3 profiliranje (slika 5e) potvrdili su da te stanične linije ovise o MCL-1 za preživljavanje. Obje su stanične linije bile osjetljive (stanična održivost IC50 <10 µM) na A-1210477 (slike 5b i d), što je potvrdilo da ovaj spoj može ubiti stanične linije ovisne o MCL-1.

Image

A-1210477 ubija stanične linije raka NSCLC ovisne o MCL-1. NSCLC stanične linije ( a ) H2110 ili ( c ) H23 transficirane su s konstruktom koji izražava MCL1 CDS označen s epitepom zastave ili praznim kontrolnim vektorom. Te su stanice naknadno transficirane sa siRNA koja ciljaju MCL1 CDS, MCL1 3 'UTRa ili UTRb, ili kodiranu kontrolnu sekvencu. Stanična vitalnost je procijenjena 72 sata kasnije s MCL-1 i Flag imunoblotsima koji su izvedeni paralelno. ( b ) Stanice H2110 ili ( d ) H23 tretirane su povećanim koncentracijama A-1210477 tijekom 72 sata prije procjene stanične vitalnosti. Sve podatkovne točke predstavljaju sredstva trostrukih eksperimenata, s trakama grešaka koje ukazuju na SEM ( e ) Stanice koje su na Digitonin-permeabilizirane H23 bile su tretirane s 10 µM BH3 peptida 4 h prije izoliranja citosolnih frakcija, koje su imunolokirane pomoću antitijela citokroma c

Slika pune veličine

A-1210477 sinergira s navitoklaksom da inducira apoptozu u više staničnih linija karcinoma

MCL-1 je dobro okarakteriziran kao faktor otpornosti na BCL-2 / BCL-X L inhibitore ABT-737 i navitoclax. Mnogo je primjera inhibicije MCL-1, tipično putem knockdown-posredovanog siRNA-om, senzibiliziranja staničnih linija raka na ubojstvo pomoću ABT-737. 16, 17, 18, 19, 52 Stoga smo testirali kombinaciju navitoklaksa i A-1210477 na ploči staničnih linija karcinoma za koje je poznato da ovise o BCL-X L i MCL-1 za preživljavanje, na primjer, staničnu liniju karcinoma želuca EJ-1. 19, 52 Kao što se i očekivalo, navitoklaks je imao malo ili nimalo utjecaja na ove stanične linije do 3–5 µM , koncentracije koje obično ubijaju stanice ovisne samo o BCL-2 i / ili BCL-X L (Slika 6). A-1210477 značajno je pomaknuo krivulju doza-odgovor navitoklaksa u stanicama BxPC-3, EJ-1, H23 i OPM-2, ukazujući na sposobnost potenciranja učinka inhibicije BCL-2 / BCL-X L. Doista, Bliss analiza ovisnosti pokazala je da su ove kombinacije vrlo sinergističke. Ovi podaci nadalje pokazuju da razrađene molekule indola-2-karboksilne kiseline ovdje opisane doista su stanično aktivni inhibitori MCL-1 koji se ponašaju kako je predviđeno u senzibiliziranju stanica raka na učinke BCL-2 / BCL- XL inhibitora.

Image

A-1210477 sinergira s navitoklaksom za ubijanje hematoloških i čvrstih staničnih linija tumora. Stanice BxPC-3, EJ-1, H23 i OPM-2 tretirane su povećanim koncentracijama navitoklaksa u prisutnosti ili odsutnosti povećanih koncentracija A-1210477 48 sati prije procjene vitalnosti stanica. Sve podatkovne točke predstavljaju sredstvo trostrukih eksperimenata, s trakama pogrešaka koje ukazuju na SEM

Slika pune veličine

Rasprava

Mimetici male molekule BH3 kao što su ABT-737, ABT-263 (navitoklaks) i ABT-199 (venetoklaks) opsežno su korišteni za rasvjetljavanje funkcija BCL-2 i BCL-X L u tumoru i normalno preživljavanje stanica. Navitoclax i BCL-2-selektivni inhibitor venetolaks također se ispituju u klinici, gdje pokazuju protuumorsko djelovanje kod hematoloških karcinoma. Nedavno su opisani i BCL-X L- selektivni inhibitori. 12, 13, 14, 15 MCL-1 vjerojatno je faktor otpornosti na sve ove spojeve i sam po sebi predstavlja atraktivan cilj raka. Međutim, stvaranje direktnih inhibitora MCL-1 s svojstvima potrebnim za ciljno stanično djelovanje pokazalo se kao glavni izazov. Iako su opisani sumnjivi inhibitori MCL-1, nedostaje 35, 36, 37, 38, 39, 53, 54 uvjerljivih dokaza da djeluju na mehanizam. Prema našem iskustvu, sub-nanomolarni i često niski pikomolarni afiniteti potrebni su da se male molekule natječu s endogenim ligandima visokog afiniteta za vezivanje na anti-apoptotičke proteine, poput BCL-2 i BCL- XL . Budući da nijedna do sada opisana mala molekula nema afiniteta za vezanje MCL-1 u ovom rasponu, malo je vjerojatno da mogu izravno inhibirati MCL-1 u staničnom kontekstu, i doista, mehanizam nekih od tih molekula je bio doveo u pitanje. 55, 56, 57, 58

Ovdje smo opisali prve selektivne inhibitore malih molekula MCL-1 s afinitetom potrebnim za dodjelu ciljane stanične aktivnosti. Ove molekule, na primjer s A-1210477, povezale su MCL-1 s sub-nanomolarnim afinitetima i pokazale sposobnost da poremete endogene interakcije proteina MCL-1-BH3 samo u četiri različita biološka ispitivanja. Koristeći dva hibridna ispitivanja sisavaca i platformu za obradu ćelija koja prati interakcije BCL-2 u stvarnom vremenu, otkrili smo da A-1210477 može selektivno poremetiti komplekse MCL-1-NOXA i MCL-1-BIM2A u živim stanicama. Intrigantno, analozi A-1210477 i indola-2-karboksilne kiseline sa sličnim, sub-nanomolarnim afinitetima za MCL-1 ponašali su se slično egzogeno eksprimiranim BH3 proteinima, uzrokujući porast MCL-1 proteina ovisnog o koncentraciji, što se moglo primijetiti počevši od sub µ M koncentracije. Međutim, manje razrađeni analog A-962653, koji veže MCL-1 s nižim afinitetom ( K i = 130 nM) usporedivim s drugim nedavno opisanim MCL-1 inhibitorima, nije imao učinka. A-1210477 je također aktivirao svojstveni put apoptoze u staničnoj liniji karcinoma ovisnog o MCL-1, pokrećući oslobađanje citokroma c iz mitohondrija, aktivaciju kaspaze-3 / -7 i eksternalizaciju fosfatidilserina u roku od sat vremena. Konačno, ti spojevi selektivno su ubili MCL-1 ovisne stanične stanice raka (H929, H2110 i H23) i sinergirali s navitoklaksom BCL-2 / BCL- XL inhibitorom da uništi stanične linije koje se za preživljavanje oslanjaju na više članova obitelji BCL-2 (BxPC-3, EJ-1, OPM-2).

Iako se pokazalo da drugi navodni inhibitori MCL-1 induciraju svojstvenu apoptozu, to ne dokazuje da djeluju izravno na MCL-1. U našim rukama, pravi BH3 mimetici, poput navitoklaksa, venetoklaksa i A-1155463, induciraju obilježja apoptoze u roku od 2-3 sata od primjene na osjetljivu staničnu populaciju. 6, 11, 15 Bilo koji broj neizravnih mehanizama može dovesti do apoptoze tijekom duljih vremenskih razdoblja, pa činjenica da određena molekula ulazi u svojstveni put apoptoze, često nakon 24 sata liječenja, nije dovoljna da ukazuje na to da je izravni inhibitor obitelji BCL-2. Nadalje, treba biti pažljiv u odabiru staničnih linija koje se koriste za procjenu ciljane aktivnosti. Potvrda da su stanice doista ovisne o MCL-1 za preživljavanje je od ključnog značaja ako se trebaju koristiti kao standard za ispitivanje sumnjivih inhibitora MCL-1. Koristili smo kombinaciju biokemijskog (BH3 profiliranja) i stanično / molekularne biologije (spašavanje siRNA) za validaciju MCL-1 ovisnosti staničnih linija poput H929, H2110 i H23, što se smatra pouzdanim za procjenu učinaka MCL-1 inhibitori. Nažalost, potvrđene stanične linije nisu uvijek korištene za procjenu ostalih mogućih MCL-1 inhibitora. Zapravo, u jednom slučaju se pokazalo da stanična linija korištena za procjenu inhibicije ciljane inhibicijom i ubijanje stanica u biti ne utječe kada se proteini MCL-1 potpuno razruše tijekom 72 sata. 37 Ovi primjeri prikazuju neke izazove i zamke povezane s validacijom inhibitora malih molekula kao pouzdanih bioloških sondi.

Workman i Collins 59 nedavno su pregledali spoznaje zajednica kemijske biologije i otkrivanja lijekova tijekom nekoliko desetljeća sinteze i primjene inhibitora malih molekula kao sonde za disekciju biologije, potvrđivanje terapijskih ciljeva i razvoj odobrenih terapija. Opisali su niz 'faktora kondicije' koji obuhvaćaju selektivnost, moć i kemijska svojstva koja se trebaju uzeti u obzir prilikom procjene korisnosti sonde u određenom biološkom kontekstu. Kao što je ovdje pokazano, A-1210477 i njegovi srodni analozi ispunjavaju ove kriterije: vežu MCL-1 s velikom selektivnošću u odnosu na druge proteine ​​iz porodice BCL-2 (a također i razne kinaze i GPCR; podaci nisu prikazani), pokazuju pot- nanomolarni afinitet za MCL-1 u biokemijskim ispitivanjima i sposobni su inhibirati MCL-1 izravno u stanicama u niskim mikromolarnim koncentracijama. Razlika između ciljanog afiniteta i stanične potencije može se barem djelomično pripisati fizikalno-kemijskim svojstvima. Na primjer, zverterionska priroda farmakofora može nametnuti ograničenja na difuziji pasivne membrane 60 i, slično drugim inhibitorima BCL-2 porodice, 15 A-1210477 i srodnim analogima su visoko vezani za proteine. To se odražava pomakom od 15 puta u afinitetu MCL-1 u prisutnosti 10% ljudskog seruma i mjereno vezivanje ljudskog proteina> 99%. 44 Ove molekule induciraju sve očekivane obilježja unutarnje apoptoze u staničnoj liniji ovisnoj o MCL-1 i ponašaju se kako se očekuje u kontekstu stanica ovisnih o MCL-1 za otpornost na navitoklaks inhibitora BCL-2 / BCL-XL. Stoga prevladavanje dokaza izloženih u ovom istraživanju ukazuje na to da te molekule djeluju na cilj i stoga su pouzdani alati za ispitivanje funkcije MCL-1 in vitro .

Ključno pitanje na koje ove studije nemaju odgovor je hoće li normalno tkivo podnijeti inhibiranje MCL-1 na razini potrebnoj za terapijsku korist. Najbolja predviđanja potencijalnih toksičnih točaka bila su iz Mcl-1 nokaut modela. 23 Na temelju ovih studija, mogu se predvidjeti srčana, jetrena i hematološka toksičnost za male molekulske inhibitore MCL-1. 61, 62, 63, 64, 65, 66, 67, 68 Međutim, budući da MCL-1 može obavljati suštinske funkcije koje nisu povezane sa sekvestracijom pro-apoptotičkih proteina, 23, 69, i dalje je moguće da inhibicija mimetikom BH3 sa malim molekulama može biti bolje tolerirana od potpunog gubitka proteina MCL-1. Također je moguće da se djelovanje protiv tumora može postići djelomičnom inhibicijom MCL-1, koji može biti manje toksičan. Zaista, pokretanje tumora izazvanih MYC-om značajno je inhibiralo izbacivanjem jednog alela Mcl-1 , iako normalno tkivo nije bilo pogođeno. 30, 70 Zasad, službeni dokaz koncepta mora čekati stvaranje snažnijih inhibitora MCL-1 s poboljšanim svojstvima sličnim lijekovima. Unatoč tome, A-1210477 i ostale ovdje opisane molekule su prvi MCL-1-selektivni BH3 mimetici s dovoljno potencijala da pokažu jasnu, ciljanu staničnu aktivnost. Ovi spojevi bit će neprocjenjivi alati za istraživačku zajednicu i predstavljat će još jednu prekretnicu u potrazi za ciljanim tretmanima koji će koristiti pacijentima sa značajnim nezadovoljnim medicinskim potrebama.

Materijali i metode

Stanična kultura

Svi humani NSCLC, rak pluća malih stanica, rak jednjaka i multipli mijelomski stanični niz dobiveni su iz ATCC (Manassas, VA, SAD) i uzgajani u skladu s prodavačkim specifikacijama. T-REx-293 stanice dobivene su iz Life Technologies (Carlsbad, CA, SAD) i održavane su, kako je prethodno opisano. 48

Testovi proliferacije i vitalnosti stanica

Adherentne ćelijske linije sjemenjane su u 50 000 stanica po jažici u pločicama s 96 jažica i tretirane su 48 sati spojevima razrijeđenim u pola-log koracima počevši od 30 μM i završavajući na 0, 001 μM. Višestruke stanice mijeloma zasijane su na 15 000 –20 000 stanica po jamici i tretirano na sličan način. Učinci na proliferaciju i održivost određeni su primjenom CellTiter-Glo reagensa iz Promega (Madison, WI, USA) prema uputama proizvođača. ICso vrijednosti određene su nelinearnom regresijskom analizom podataka o koncentracijskom odgovoru.

Testovi preraspodjele stanica

Eksperimenti su provedeni kao što je prethodno detaljno. 48 Snimanje je izvedeno s ciljem 40 ELWD Plan Fluor (NA: 0, 6, Nikon, Melville, NY, USA) na Nikon Ti-E savršenom invertiranom mikroskopu sa savršenim fokusom opremljenim okretnim diskom konfokalnim CSU-X1 (Andor, Oxford Instruments, Belfast, Velika Britanija), motorizirani X, Y stupanj (Nikon), ekološka komora (OkoLab, Pozzuoli, Italija) i iXon3 897 EMCCD kamera (Andor, Oxford Instruments), kontrolirana softverom NIS-Elements (Nikon). Sve analize provedene su korištenjem MATLAB (verzija R2012b, Mathworks, Natick, MA, SAD) na 16-bitnim slikama u sivim tonovima eGFP-BCL-2 familije proteina ili mCherry-BH3 samo proteina. Mitohondrijski odjeljak identificiran je kao eGFP, male, izolirane strukture (> ~ 4 µm 2 i <80 µm 2 ) iznad lokalnog pozadinskog intenziteta. Za razliku od Wong i sur. , Nisu opažena 48 područja koja su specifična za nuklearnu energiju. Stoga je cijela stanica identificirana s jednim pragom intenziteta primijenjenim na eGFP fluorescenciju, isključujući područja koja su identificirana kao mitohondrije. Prosječni intenziteti prijavljeni su na razini slike, normalizirani na ukupnu površinu svakog identificiranog odjeljka. Izračunat je omjer intenziteta mitohondrija / mitohondrijala mCherry / citoplazmatskog intenziteta, a podaci su normalizirani i prikazani kako je opisano. 48 Podaci su analizirani iz 10 vidnih polja po stanju u dva odvojena pokusa.

Antitijela i reagensi

Antitijela za studije ko-imunoprecipitata MCL-1-BIM dobivena su od Thermo Fisher Scientific (Waltham, MA, USA; anti-MCL-1 klon RC13) i Abcam (Cambridge, MA, USA; anti-BIM klon Y36). Sekundarna protutijela protiv zeca-HRP i anti-miš-HRP protutijela kupljena su od Amersham Biosciences (Piscataway, NJ, SAD). Sve su kemikalije kupljene od tvrtke Sigma (St. Louis, MO, USA). Antitijela za imunoblote dobivena su iz Abcam (anti-NOXA klon 114C307), BD bioznanosti (San Jose, CA, USA; anti-BCL-X L klon 4), Sigma (anti- β- aktinski klon AC-15) i Santa Cruz (La Jolla, Kalifornija, SAD; anti-MCL-1 klon S-19).

transfekcije siRNA i eksperimenti spašavanja

siRNA koje ciljaju MCL1 dobivene su iz Dharmacon-a (Lafayette, CO, USA) ili Qiagen (Valencia, CA, SAD). Sekvence su bile sljedeće: kodirajuća sekvenca (CDS; Dharmacon) GCAUCGAACCAUUAGCAGAUU, neprevedena regija a (UTRa) (Dharmacon) CGAAGGAAGUAUCGAAUUU i UTRb (Qiagen) CCCGCCGAAUUCAUUAAAAUUA. Stanice su sijane u posude od 10 cm po 1, 5 × 10 6 po posudi dan prije transfekcije. Za svaku transfekciju, 12, 5 µl 20 µ M zaliha siRNA miješa se sa 1, 4 ml Opti-MEM (Invitrogen, Carlsbad, CA, 5 minuta) na sobnoj temperaturi. Sve skupa, 22, 4 µl lipofektamina 2000 (Invitrogen) se pomiješalo s 1, 4 ml Opti-MEM-a tijekom 5 minuta. Dvije otopine su zatim miješane 30 minuta prije nego što su dodane u stanice prekrivene 2, 2 ml medija (konačna koncentracija siRNA od 50 nM). Nakon 4 sata inkubacije na 37 ° C, transfekcijska otopina je uklonjena i zamijenjena svježim medijem. Stanični lizati su pripremljeni 3 dana kasnije.

Testovi afiniteta za vezivanje

Analiza afiniteta za vezanje TR-FRET provedena je za BCL-2, BCL-X L i MCL-1 u 4, 52 mM monobaznom kalijevom fosfatu, 15, 48 mM dvostrani kalijev fosfat, 1 mM natrijevog EDTA, 0, 05% deterdženta Pluronic F-68, 50 mM natrijevog klorida i 1 mM DTT (pH 7, 5) kako je prethodno opisano za BCL- XL . 6 Za ispitivanja MCL-1, GL-označeni MCL-1 (1 nM) je pomiješan sa 100 nM f-Bak, 1 nM Tb obilježenim anti-GST antitijelom i spoj na sobnoj temperaturi (RT) 60 minuta. Fluorescencija je izmjerena na čitaču ploča Envision (Perkin-Elmer, Waltham, MA, SAD) koristeći ekscitacijski filter 340/35 nm i 520/525 (f-Bak) i 495/510 nm (protutijela s Gb-oznakom Tb) emisijski filtri.

Dva hibrida sisavaca

HeLa stanice koje stabilno eksprimiraju izvjestitelj GAL4-luciferaze posijane su u posude od 10 cm po 5 × 105 stanica po ploči. Sve u svemu, 24 µg plazmida koji eksprimira fuzijske proteine ​​i „mamac“ i „plijen“ (GAL4DBD-BIM i VP16AD-BCL-2, GAL4DBD-BCL-X L i VP16AD-BCL-XS ili GAL4DBD-MCL -1 i VP16AD-NOXA, pomiješani su s 1.5 ml OptiMEM (Invitrogen). Zasebno se pomiješalo 24 μl lipofektamina 2000 (Invitrogen) s 1, 5 ml OptiMEM-a. Obje otopine se inkubiraju 5 minuta (RT) i zatim miješaju zajedno 20 minuta. Tri mililitara smjese dodano je stanicama u mediju sa 12 ml kulture bez antibiotika, inkubirano 24 sata na 37 ° C, a zatim prebačeno na pločice s 96 jažica s 20 000 stanica po jažici. Spojevi su dodani u razrjeđivanjima s pola log, počevši od 1 μM i završavajući na 0, 0001 μM tijekom 24 sata, a aktivnost luciferaze procjenjena je primjenom ONE-Glo reagensa (Promega). Svi su podaci prikazani kao postotak ostatka kompleksa u odnosu na neobrađenu kontrolu.

Electrochemiluminescent ELISA

Nakon složenih tretmana, stanice su lizirane u puferu koji sadrži 1% CHAPS, 10 mM HEPES i 150 mM NaCl sa koktelom inhibitora proteaze (Roche, Indianapolis, IN, USA). Sveukupno, 100 µg staničnog lizata dodano je u svaku jažicu ploče s Meso Scale Discoveryjem (Rockville, MD, USA) 96-jažnom pločicom prethodno prevučenom biotiniliranim anti-MCL-1 antitijelom (klon RC13) tvrtke Thermo Fisher Scientific. MCL-1-BIM kompleksi detektirani su s zečjim anti-BIM antitijelom (klon Y36) iz tvrtke Abcam, zatim Sulfo označenim anti zečjim antitijelom (Meso Scale Discovery; kat. Br. R32AB-5) i Meso Scale Discovery puferom za čitanje s površinski aktivnom tvari (kataloški br. R92TC-2) prema preporukama proizvođača. Svaki korak je praćen tri puta ispiranjem s PBS-T (PBS + 0, 1% Tween-20).

Ekstrakcija proteina i imunoblotska analiza

Stanice su isklesane u hladni PBS, granulirane su i zatim resuspendirane u 100–200 µl ledeno hladnom puferu za lizu insekata uz dodatak inhibitora proteaze (BD Biosciences Pharmingen, San Diego, CA, SAD). Stanice su lizirane sonikacijom, a krhotine su očišćene mikrocentrifugom. Ukupno je 40 μg lizata napunjeno u svaku jažicu od 6 ili 10% Tris-glicin poliakrilamid minigela (Invitrogen) za SDS-PAGE analizu. Proteini su preneseni u PVDF membrane (Invitrogen), blokirani 1 sat u TBS-T plus 5% (w / v) mlijeka s prahom za razmrljavanje u prahu (Bio-Rad Laboratories, Hercules, CA, SAD), a potom provedena preko noći na 4 ° C s primarnim antitijelima pri razrjeđenju 1: 2000 u blokirajućoj otopini. Mrlje su razvijene upotrebom reagensa za pojačanu kemiluminiscenciju (ECL Plus) tvrtke Amersham Biosciences.

Mehanizam studija djelovanja

Stanice H929 uzgajane su u RPMI 1640 (Invitrogen Corp., Grand Island, NY, USA) sa dodatkom 10% fetalnog goveđeg seruma (Invitrogen), 1% natrijevim piruvatom, 25 mM HEPES, 4, 5 g / l glukoze i 1% penicilina / streptomicin (Sigma) i održavan u vlažnoj komori na 37 ° C, koja sadrži 5% CO2. Za procjenu oslobađanja citohroma c , 1 × 106 6 H929 stanice su tretirane 4 sata BH3 peptidima (10 µM ) ili spojevima (razrjeđivanje polu-log počevši od 10, 0 µM i završava na 0, 1 µM ) prije stvaranja mitohondrija i citosola frakcije kao što je prethodno opisano. 11 Za sve ostale studije, stanice H929 postavljene su u pločice s kulturom od 96 jažica na 100 000 stanica / jažici u 100 μl RPMI dopunjene 10% FBS. Aktivacija kaspaze blokirana je primjenom pan-kaspaznog inhibitora Q-VD-OPh hidrata (QVD; Sigma). QVD (40 mM zaliha u DMSO) dodan je u odgovarajuće jažice do konačne koncentracije 100 μM pomoću digitalnog dozatora HP D300 (Tecan, Männedorf, Švicarska), a stanice su prethodno obrađene 1 sat prije dodavanja dodatnih spojeva, Selektivni spojevi MCL-1 (10 mM zaliha u DMSO) dodani su uporabom digitalnog dozatora HP D300 i stanice su tretirane dodatna 4 sata. Nakon tretmana, svojstva apoptoze (aktiviranje kaspaze-3 / -7, depolarizacija mitohondrijalne membrane i eksternalizacija fosfatidilserina) izmjereni su pomoću IntelliCyt (Albuquerque, NM, USA) MultiCyt 4-Plex probirnog kompleta za apoptozu prema uputama proizvođača i očitava protočnom citometrijom pomoću HTFC probirnog sustava (IntelliCyt). Ukratko, 20 μl obrađenih stanica prebačeno je na ploču s V-dnom s 96 jažica koja sadrži 20 µl koktel koji se sastoji od vlastite kombinacije boja i inkubira se 1 sat na 37 ° C prije očitanja. Podaci su izraženi kao postotak singletnih stanica. Za preostalih 80 μl tretiranih stanica utvrđena je održivost korištenjem reagensa CellTiter-Glo (Promega).

Dodatna informacija

Datoteke Powerpoint

  1. 1.

    Dodatna informacija

Word dokumenti

  1. 1.

    Dodatna informacija

Glosar

BH3

BCL-2 homologija 3

CDS

redoslijed kodiranja

EGFP

pojačani zeleni fluorescentni protein

ELISA

enzimski imunosorbentni test

NSCLC

ne-stanični karcinom pluća

TR-FRET

vremenski rezolucija fluorescentnog rezonantnog prijenosa energije

UTR

neprevedena regija

Dodatne informacije nalaze se u ovom radu na web stranici Cell Death and Disease (//www.nature.com/cddis)