Xab2 funkcionira u progresiji staničnog ciklusa mitoze transkripcijskom regulacijom cenpe | stanična smrt i bolest

Xab2 funkcionira u progresiji staničnog ciklusa mitoze transkripcijskom regulacijom cenpe | stanična smrt i bolest

Anonim

teme

  • Terapija raka
  • Stanična signalizacija
  • Mitoza
  • Transkripcija

Sažetak

Protein 2 koji veže Xeroderma pigmentosum skupinu A (XPA) (XAB2) je multifunkcionalni protein koji ima kritičnu ulogu u procesima koji uključuju transkripciju, popravljanje DNA vezanog za transkripciju, spajanje pre-mRNA, homolognu rekombinaciju i izvoz mRNA. Microarray analiza ekspresije gena u XAB2 stanicama obrušavanja otkriva da mnogi geni sa značajnom promjenom funkcije ekspresije u regulaciji mitotičkog staničnog ciklusa. Analiza staničnog skenera aktiviranog fluorescencijom potvrdila je da je iscrpljivanje XAB2 dovelo do zaustavljanja stanica u fazi G2 / M, većinom u fazi profaze ili prometafaze. Slika živih stanica nadalje otkriva da je padom XAB2 izazvano ozbiljno mitotičko oštećenje, uključujući kromosomsko pomicanje i oštećenja segregacije, što dovodi do zaustavljanja mitoze, mitotske katastrofe i naknadne stanične smrti. Među vrhunskim genima koji su regulirani XAB2 iscrpljivanjem je i protein E (CENPE) koji je povezan sa mitotičkim motornim proteinima. Knockdown CENPE pokazao je slične fenotipe gubitku XAB2, ali knockdown CENPE praćen XAB2 osiromašenjem nije dodatno pojačao zaustavljanje staničnog ciklusa. Analiza luciferaze na promotoru CENPE pokazala je da prekomjerna ekspresija XAB2 povećava aktivnost luciferaze, dok iscrpljivanje XAB2 rezultira izrazitim smanjenjem aktivnosti luciferaze. Daljnjim mapiranjem otkriveno je područje u CENPE promotoru koje je potrebno za regulaciju transkripcije XAB2. Štoviše, ispitivanje ChIP pokazalo je da XAB2 komunicira s promotorom CENPE. Zajedno, ovi rezultati podržavaju novu funkciju XAB2 u regulaciji mitotičkog staničnog ciklusa, koja je djelomično posredovana regulacijom transkripcije na CENPE.

Glavni

Protein 2 koji veže Xeroderma pigmentosum skupinu A (XPA) (XAB2) je visoko konzervirani gen, koji je prvobitno identificiran u čovjeku kao protein koji je u interakciji s XPA, koristeći dvo-hibridni sustav kvasca. 1 Humani XAB2 gen smješten je na kromosomu 19p13.2, koji kodira protein od 855 aminokiselina molekulske mase 100 kDa. Protein XAB2 sadrži 15 tetratrikopeptidnih ponavljajućih motiva koji su uključeni u interakcije protein-protein i sastavljanje multiproteinskih kompleksa. Ima mnogo ortologa, poput SYF1 u Saccharomyces cerevisiae , 2, 3 ATH55 u štakora 4 i Fandango u Drosophila. 5

Objavljeno je da XAB2 može komunicirati s proteinima grupe A i B sindroma Cockaynea (CSA i CSB), kao i RNA polimerazom II, a smanjivanje XAB2 upotrebom anti-XAB2 antitijela ili siRNA posebno inhibira normalnu sintezu RNA i obnavljanje sinteze RNA nakon UV zračenja, što ukazuje da je XAB2 uključen u popravak DNA i obnavljanje transkripcije. Daljnje studije pokazuju da se XAB2 može vezati na hiperfosforilirani oblik RNA polimeraze II na način ovisan o UV i CSA / CSB 7 i doprinijeti produženju transkripcije. 6 Nadalje, XAB2 je uključen kao komponenta Prp19 / XAB2 kompleksa 6 (hAquarius, XAB2, Prp19, CCDC16, hISY1 i PPIE) ili Prp19 / CDC5L srodnog kompleksa 8 potrebnog za spajanje pre mRNA. Tijekom spajanja, Prp19 kompleks se regrutuje za spliceosom i ključan je za aktivaciju spliceosoma stabiliziranjem U5 i U6 s spliceosomom nakon U4 disocijacije. 9, 10 U Hela stanicama, Prp19 / XAB2 kompleks prijavljen je da se povezuje s RNA, a ne s DNA, a propadanje XAB2 spriječilo bi spajanje Bcl-x pre-mRNA. 6 Slično tome, SYF1, homolog XAB2 u kvascu, također je identificiran kao faktor uključen u spajanje pre-mRNA, 2, 3 i novi faktor produženja transkripcije povezivanjem Prp19 kompleksa s RNA polimerazom II kroz njegovu C terminalnu domenu. 11

XAB2 je također važan za ranu embriogenezu miša, jer je dokazano da propadanje XAB2 u miševa dovodi do embrionalne letalnosti. 12 Prethodno je pokazano da XAB2 može komunicirati s receptorom retinoične kiseline A i histonskom deacetilazom 3, a manjak XAB2 povećava staničnu diferencijaciju uzrokovanu sve trans-retinoičnom kiselinom (ATRA) u stanicama karcinoma osjetljivih i otpornih na ATRA. Ovi rezultati sugeriraju da XAB2 može pokazati inhibitorni učinak u staničnoj diferencijaciji uzrokovanoj ATRA-om. 13 Nadalje, XAB2 može igrati ulogu u tumorigenezi. Ekspresija XAB2 značajno je regulirana kod primarnog karcinoma želuca, 14 trostruko negativnog karcinoma dojke 15 i dugogodišnjeg preživjelog atipičnog teratoidnog / rabdoidnog tumora, 16 dok se on regulira kod raka jajnika 17 i sarkoma 18 pomoću baze podataka Oncomine (www.oncomine org). XAB2 tagSNPs (rs794078 i rs4134816) dramatično su povezani s rizikom ne-staničnog raka pluća kod kineske populacije. 19 Uz to, razina XAB2 izrazito je smanjena u starenim stanicama hematopoetskih stanica, što sugerira ulogu u starenju. 20 Nedavno smo pokazali da je XAB2 predstavljen u ribonukleo proteinu konsenzusnog elementa koji se nalazi u prirodno mronima bez intratona koji može pospješiti izvoz mRNA, a poremećaj XAB2 doveo je do nuklearne zadržavanja mRNA bez intrana, što sugerira ulogu XAB2 u prirodnoj mRNA bez irona. izvoz. 21 Nedavno je objavljeno da XAB2 regulira korak krajnje resekcije tijekom homologne rekombinacije popravljanja kromosomskih lomova s ​​dvostrukim žicama. 22 Dakle, XAB2 je važan višenamjenski protein.

Unatoč kritičnim funkcijama XAB2 u ekspresiji gena, daljnji ciljni geni i sljedeće fiziološke uloge u ljudskim stanicama još uvijek nisu poznati. Ovdje radimo analizu mikrorastanja na stanicama Hela transfektiranim s XAB2 shRNA, otkrivajući da XAB2 modulira ekspresiju značajnog broja gena, koji su najjače uključeni u stanični ciklus i mitotsku progresiju. Nadalje pokazujemo da XAB2 rušenje prouzrokuje neusklađivanje i missegregaciju kromosoma, nenormalnu nuklearnu strukturu, vretenast stup i organizaciju mikrotubula, što dovodi do hapšenja mitoze, mitotske katastrofe i kasnije ćelijske smrti. Mehanička analiza otkriva da je fenotip koji se primjećuje u stanicama s iscrpljivanjem XAB2 posredovao kinezinima sličnim motoričkim proteinima zvanim centrosomom povezan protein E (CENPE), čija je transkripcija regulirana XAB2. Uzeto zajedno, naši podaci pokazuju da XAB2 regulira napredovanje mitoze kontrolom transkripcije CENPE.

Rezultati

Microarray analiza otkriva da XAB2 knockdown rezultira apberantnom ekspresijom mnogih gena koji sudjeluju u mitotičkom staničnom ciklusu

Prethodne studije pokazale su da je XAB2 multifunkcionalni protein koji igra kritičnu ulogu u transkripciji, 6 spajanju 6 i izvozu mRNA. 21 Da bi se identificirali ciljni geni regulirani XAB2, genska ekspresija XL-e osiromašenih HeLa stanica analizirana je mikrorastanjem. Ova analiza otkrila je da ukupno 690 gena pokazuje značajnu promjenu u ekspresiji (> dvostruko, P <0, 05). Među njima je 216 gena bilo regulirano, a 474 gena dolje regulirano (dopunska tablica 1). Učinkovitost obustave XAB2 potvrđena je Western blot-om (slika 1a) na razini proteina kao i mikrorezom na nivou mRNA (Dodatna tablica 1, 3, 43-dolje regulirana dolje). Za provjeru podataka o mikroračunu, RT-PCR je korišten za provjeru razine ekspresije nekoliko gena, uključujući MAPK4, SERPINB5, EPGN i PRG4. Sukladno rezultatima mikroračuna, smanjena ekspresija ova četiri gena potvrđena je RT-PCR (dopunska slika S1).

Image

Analiza mikrorasta otkriva gene koji su uključeni u stanični ciklus i mitotsku progresiju kao glavne gene s promjenama ekspresije nakon XAB2 rušenja. ( a ) Genska ontološka analiza koja pokazuje funkcije gena sa značajnim promjenama u ekspresiji nakon XAB2 knockdown-a. Ploča s desne strane: zapadna mrlja koja pokazuje XAB2 bila je efikasno iscrpljena nakon što su stanice zaražene lentivirusom koji sadrži XAB2 shRNA. ( b ) Diferencijalna ekspresija gena (> dvostruko, P <0, 05) koja se odnosi na stanični ciklus i mitotsku progresiju nakon obaranja XAB2. ( c ) RT-PCR analizom su potvrđene razine ekspresije gena nakon rušenja XAB2

Slika pune veličine

Zatim je provedena genetska ontologija radi analize bioloških funkcija 690 gena s promijenjenom ekspresijom. Kao što je prikazano na slici 1a, nekoliko glavnih funkcija na koje je utjecalo bilo je povezano s regulacijom staničnog ciklusa, uključujući mitotski stanični ciklus, M fazu mitotskog staničnog ciklusa, mitotsku prometnu fazu i staničnu diobu. Prema tome, skup gena koji su uključeni u regulaciju staničnog ciklusa dereguliran je (Slika 1b), uključujući CENPE, CKAP5, CLIP1, CDC27 i Mad2L1, čija je ekspresija potvrđena RT-PCR (slika 1c). Ovi podaci zajedno su sugerirali kritičnu ulogu XAB2 u mitozi i regulaciji staničnog ciklusa.

Otpad XAB2 dovodi do zaustavljanja mitoze, mitotske katastrofe i stanične smrti

Da bi se dalje istražilo regulira li XAB2 stanični ciklus i mitotsku progresiju, provedena je analiza staničnog skenera (FACS) s fluorescentnom analizom na stanicama Hela, transficiranim s XAB2 shRNA. Iznenađujuće, knockdown XAB2 rezultirao je značajnim porastom stanica uhićenih u fazi G2 / M (32, 8% u stanicama transficiranim s XAB2 shRNA u usporedbi s 10, 6% u kontroli, P <0, 001, slike 2a i b). Da bi se isključio izvan ciljni učinak XAB2 shRNA, testirana je još jedna shRNA i dvije siRNA na njihove učinke na stanični ciklus. Slično tome, obustava XAB2 upotrebom različitih shRNA ili siRNA rezultirala je značajnim zaustavljanjem staničnog ciklusa u fazi G2 / M i u heli (dopunska slika S2A) i u stanicama 293T (dopunska slika S2B), što ukazuje da je zaustavljanje staničnog ciklusa glavna mana nakon iscrpljivanja XAB2. Dosljedno tome, ekspresija mitotičkih markera Cyclin B1 i Phospho-HistoneH3 (Ser10) očito je povećana u XAB2 knockdown ćelijama zapadnom blotom (slika 2c) i FACS analizom (dopunska slika S2C).

Image

Manjak XAB2 uzrokuje zaustavljanje mitoze, mitotsku katastrofu i staničnu smrt. ( a ) Iscrpljivanje XAB2 dovodi do nakupljanja G2 / M stanica FACS analizom. Hela stanice transficirane su kontrolnom shRNA (shNC) ili XAB2 shRNA (shXAB2) i zatim obojene s PI za analizu raspodjele staničnog ciklusa. ( b ) Količina stanica u različitim fazama staničnog ciklusa nakon iscrpljivanja XAB2 ( n = 3); *** P ≤0, 001. ( c ) Western blot otkriva povećanje regulacije CyclinB1 i Phospho-HistoneH3 (Ser10) u istrošenim stanicama XAB2. ( d ) Otpad XAB2 izaziva značajno povećanje stanica u profazi i prometafazi. Hela stanice su transficirane kontrolnom shRNA (shNC) ili XAB2 shRNA (shXAB2) i zatim imunostanirane s α -tubulinskim antitijelom i DAPI. ( e ) Količina mitotičkih stanica u različitim fazama nakon iscrpljivanja XAB2. Prebrojano je više od 100 nasumično odabranih mitotičkih stanica ( n = 3). ( f ) Slike živih stanica koje prikazuju otkucaje XAB2 rezultirale su mitotskim zaustavljanjem i staničnom smrti. ( g ) Količenje prosječnog trajanja mitoznih stanica GFP-H2B Hela s kontrolom ili XAB2 obustavom ( n = 30 stanica); *** P ≤0.001 (NEB: raspad nuklearne ovojnice). ( h ) Kvantitacija stanica u mitotičkom zaustavljanju ili mitotskom kašnjenju (trajanje mitoze> 90 min) kao što je uočeno u snimanju živih stanica. Trajanje mitoze definira se kao vremensko razdoblje od raspada nuklearne ovojnice do početka anafaze ili smrti stanice; *** P ≤0, 001. ( i ) Količenje mitotičkih ćelija smrti nakon iscrpljivanja XAB2. Prebrojano je više od 50 nasumično odabranih mitotičkih stanica ( n = 3); *** P ≤0, 001. ( j ) Otpad XAB2 uzrokuje apoptozu analizom FACS korištenjem bojenja na aneksinu V i PI. ( k ) Količina V-pozitivnih stanica na aneksinu nakon iscrpljivanja XAB2 ( n = 3); ** P ≤0.01

Slika pune veličine

Zatim su XAB2 obrubljene stanice i kontrolne stanice obojene antitijelom protiv tubulina i DAPI, značajne mitotičke stanice uhićene u fazi profaze i prometafaze uočene su u stanicama s iscrpljenjem XAB2 (82, 8 naspram 15, 1% u kontroli, P <0, 001, Slike 2d i e), daljnja potpora teških oštećenja u napredovanju mitotičkog staničnog ciklusa.

Da bismo bolje istražili funkciju XAB2 na mitotsku progresiju, potrošili smo XAB2 u stanicama HeLa stabilno eksprimirajući GFP-H2B i pratili mitozu koristeći živo stanično snimanje. Kao što je prikazano na slici 2f, dvije kćerne jezgre razdvojene su 50 min, a mitoza je završena za 70 min u kontrolnim stanicama. Suprotno tome, odvajanje jezgara nije opaženo čak ni 300 minuta u stanicama iscrpljenim od XAB2. Statistička analiza nadalje je otkrila da je prosječno trajanje mitoze od propadanja nuklearne ovojnice do anafaze produljeno sa ~ 60 min u kontrolnim ćelijama do 290 min u stanicama s XAB2 iscrpljenjem (slika 2 g, P 90 min) drastično je povišeno sa 4, 9 na 81, 2% ( Slika 2h, P <0, 001). Nadalje, stanice podvrgnute mitotskoj staničnoj smrti značajno su porasle nakon propadanja XAB2 sa 3, 9 na 65, 8% (Slika 2i, P <0, 001). Da bi se dodatno ispitalo je li XAB2 prouzrokovana destrukcija stanica nakon mitotske katastrofe, provedena je FACS analiza nakon bojenja aneksinom V i propidijum jodida (PI). Kao što je prikazano na slikama 2j i k, postotak V-pozitivnih stanica aneksina očito je porastao u obrubljenim stanicama XAB2 s 5, 8 na 24, 7%, što ukazuje na značajnu staničnu smrt nakon iscrpljivanja XAB2. Uzeto zajedno, ovi podaci pokazuju da je nedostatak XAB2 rezultirao mitotskim zaustavljanjem, mitotskom katastrofom i staničnom smrću.

Otpad XAB2 uzrokuje oštećenja kromosoma i segregaciju

Budući da mitoza zahtijeva strogu kontrolu kretanja kromosoma, zatim smo izvršili DAPI bojenje kako bismo utvrdili utječe li XAB2 na usklađivanje i segregaciju kromosoma. Ova analiza otkrila je teško neusklađivanje kromosoma na ekvatorijalnoj ploči i međunuklearnim DNK mostovima (slika 3a).

Image

Otpad XAB2 dovodi do neusklađivanja kromosoma i pogrešne segregacije. ( a ) Misaligni / missegregirani kromosomi i međunuklearni mostovi uočeni u stanicama koje su oštećene XAB2. ( b ) Slike živih stanica koje pokazuju XAB2 propadanje rezultirale su mitotskim zaustavljanjem, mitotskim kašnjenjem i defektom segregacije. ( c ) Kvantitacija mitotskih stanica nakon iscrpljivanja XAB2 pokazala je značajan porast mitotičkog zastoja, kašnjenja mitotike i oštećenja segregacije

Slika pune veličine

U skladu s prethodnim promatranjem, većina mitotičkih stanica pokazuje mitotski zaustavljanje, mitotičko kašnjenje ili segregacijski defekt. Konkretno, mitotski zaustavljanje profaze ili prometafaze s oštećenjem usklađivanja kromosoma zabilježeno je u 43, 1% mitotičkih stanica nakon iscrpljivanja XAB2 u usporedbi s 2, 6% u kontroli, koje se nisu podijelile i na kraju dovele do smrti stanica (Slike 3b i c). Mitotsko kašnjenje uočeno je u 33, 2% mitotičkih stanica nakon pada XAB2 nasuprot 4, 2% u kontroli, te su se stanice još uvijek mogle podijeliti nakon kašnjenja mitota s neusklađivanjem kromosoma, ali i s defektom segregacije kromosoma što je rezultiralo stvaranjem internuklearnih mostova DNA (Slike 3b i c). Dok je defekt segregacije bez kromosomskog neusklađivanja također primijećen u 16, 3% mitotičkih stanica u usporedbi s 6, 9% u kontroli (Slike 3b i c). Obje stanice mitotičkog kašnjenja ili oštećenja segregacije pokazale su nenormalnu nuklearnu strukturu i uginule su u progresiji staničnog ciklusa (Slika 3b). Ti su podaci pokazali ozbiljne nedostatke u usklađivanju kromosoma i segregaciji nakon XAB2 rušenja.

Manjak XAB2 inducira nenormalni vretenasti pol, nuklearnu strukturu i organizaciju mikrotubula i razbijanje DNK

Dalje smo pokušali istražiti kako se mitoza remeti u knockdown XAB2 stanicama. Najprije je provjeren pol vretena u stanicama s iscrpljenom XAB2 jer je potrebno ispravno formiranje vretena za poravnavanje i segregaciju kromosoma. Zapanjujuće su pojedinačni ili višestruki vretenasti stubovi uočeni u ~ 30 i ~ 8% stanica profaze / prometafaze nakon obaranja XAB2 korištenjem obojenja tubulinom ili Aurorom A (Slike 4a i b). Drugo, nenormalne nuklearne strukture, uključujući nuklearne mjehuriće, oblik kikirikija ili nepravilno jezgro, primijećene su u većini interfaznih stanica nakon iscrpljivanja XAB2 (Slika 4c). U međuvremenu, organizacija mikrotubula također je bila ozbiljno narušena. Zapaženo je nepravilno skupljanje mikrotubula na jednoj strani jezgre u usporedbi s ravnomjernom raspodjelom u kontrolnim stanicama (Slika 4c). Treće, ispitivana su oštećenja DNK u obrušenim ćelijama XAB2 jer su nuklearni mjehurići obično povezani s razbijanjem DNA. 23, 24 Kao što je prikazano na slikama 4d i e, ekspresija DNA markera Phospho-Histone H2A.X ( γ- H2A.X) značajno je povećana u obrušenim stanicama XAB2 i imunofluorescentnom bojom, i analizom western blot-a. Ovi podaci zajedno pokazuju da je XAB2 kritičan za organizaciju mikrotubula i vretena kao i za stabilnost genoma.

Image

XAB2 knockdown rezultira nepotpunim vretenastim stupom, poremećenom organizacijom mikrotubula i povećanjem oštećenja DNA. ( a, b ) Iscrpljivanje XAB2 dovodi do jednostrukih ili višestrukih vretenastih polova u stanicama profaze ili prometafaze. Hela stanice transficirane su kontrolnom shRNA (shNC) ili XAB2 shRNA (shXAB2), a zatim imunostanirane s α -tubulinskim antitijelom ( a ) ili Aurora A antitijelom ( b ) i DAPI. ( c ) Poremećena organizacija mikrotubula i nuklearna struktura u međufaznim ćelijama nakon XAB2 rušenja. Hela stanice su imuno obojene s a -tubulinskim antitijelom (zelena) i DAPI (plava). ( d ) Otpad XAB2 rezultira povećanim prekidima DNK, što je pokazano imunološkanjem pomoću γ -H2A.X antitijela (zeleno). ( e ) Western blot otkriva povećanje regulacije γ -H2A.X u XAB2 ćelijama za obrušavanje

Slika pune veličine

Defekti u napredovanju mitoze u stanicama za iscrpljivanje XAB2 posreduju CENPE

Sljedeći smo put istražili mehanizam kako XAB2 regulira mitozu. Primijetili smo da je CENPE, ključni faktor mitoze, jedan od glavnih gena koji su dolje regulirani u rezultatima XAB2 mikrostruje. Stoga smo testirali hipotezu da XAB2 regulira mitozu putem CENPE. Prvo, razina ekspresije CENPE u istrošenim XAB2 stanicama potvrđena je RT-PCR i western blot analizom, rezultati su pokazali da je osiromašenje XAB2 dovelo do dramatičnog gubitka CENPE i u razini mRNA i proteina (slike 1c i 5a, dopunska slika S3), Dok srušeni CENPE nije pokazao utjecaj na ekspresiju proteina XAB2, sugerirajući XAB2 funkcije uzvodno od CENPE (Slika 5b). Zatim je CENPE osiromašen u stanicama HeLa pomoću CENPE specifične siRNA, a iscrpljivanje je dovelo do 50, 0% stanica uhićenih u fazi G2 / M u usporedbi s 19, 0% u kontroli (Slike 5c i d, P <0, 001). U međuvremenu, iscrpljivanje CENPE-a također je izazvalo neusklađivanje kromosoma i zaustavljanje profaze / prometafaze (78.1% u obrušavajućim stanicama naspram 17.2% u kontroli), slično fenotipu zabilježenom u stanicama nedostatka XAB2 (slike 5e i f). Za daljnju potvrdu da li XAB2 regulira mitozu putem CENPE, HeLa stanice su tretirane s CENPE siRNA, nakon čega slijedi iscrpljivanje XAB2. Kao što je prikazano na slici 5g, samo obustava CENPE-a dramatično je uhapsila stanice u fazi G2 / M, dok CENPE pad od zadataka praćen XAB2 shRNA tretmanom nije dodatno pojačao zastoj G2 / M uzrokovan CENPE, ilustrirajući važnu ulogu CENPE u kontroli mitotske progresije induciran XAB2 osiromašenjem. Zajedno, ovi rezultati sugeriraju da XAB2 regulira mitozu putem CENPE.

Image

XAB2 regulira napredovanje mitoze putem CENPE. ( a ) Western blot pokazuje smanjenu ekspresiju proteina CENPE u XAB2 stanicama srušenja. ( b ) Western blot koji pokazuje pad CENPE-a nije promijenio razinu proteina XAB2. ( c ) Otpad CENPE dovodi do zastoja G2 / M kao što je otkriveno FACS analizom. Hela stanice transficirane su kontrolnom siRNA (siNC) ili CENPE siRNA (siCENPE) i zatim obojene s PI da se analizira raspodjela staničnog ciklusa. ( d ) Količina stanica u različitim fazama staničnog ciklusa nakon iscrpljivanja CENPE ( n = 3); *** P ≤0, 001. ( e ) Bojenje imunofluorescencije pokazuje značajno povećanje stanica profaze i prometafaze nakon propadanja CENPE. Hela stanice su transficirane kontrolnom siRNA (siNC) ili CENPE siRNA (siCENPE) i zatim imunostanirane s α -tubulinskim antitijelom i DAPI. ( f ) Količenje mitotičkih stanica u različitim fazama nakon iscrpljivanja CENPE. Prebrojano je više od 50 nasumično odabranih mitotičkih stanica ( n = 3). ( g ) Otpad CENPE-a praćen XAB2 shRNA tretmanom ne povećava zastoj G2 / M izazvan iscrpljivanjem CENPE. ( n = 3); * P 0.05

Slika pune veličine

XAB2 regulira CENPE ekspresiju na razini transkripcije

Dalje smo istražili kako XAB2 može regulirati ekspresiju CENPE. Prethodno je objavljeno da XAB2 komunicira s RNA polimerazom II i igra ulogu u transkripciji, 1, štoviše, primijetili smo da iscrpljivanje XAB2 dovodi do smanjene regulacije CENPE na razini mRNA u ovom istraživanju, sugerirajući da XAB2 može transkripcijski regulirati ekspresiju CENPE. Da bismo to testirali, prvo smo konstruirali izvjestitelj za luciferazu koji je obuhvaćao područje od 1355-bp od -1263 do +92 od početnog mjesta transkripcije CENPE. Kao što je prikazano na slici 6a, ovo područje može potaknuti transkripciju luciferaze, sugerirajući da ona služi kao promotor CENPE. Prekomjerna ekspresija XAB2 povećala je aktivnost promotora CENPE za 1, 8 puta (Slika 6a), dok je oborenje CENPE rezultiralo u upadljivom smanjenju aktivnosti luciferaze za 7, 2 puta (Slika 6b). Prevelika ekspresija i destrukcija XAB2 potvrđena je analizom Western blot-a (Slika 6c).

Image

XAB2 regulira CENPE ekspresiju na razini transkripcije. ( a ) Analiza luciferaze otkriva da prekomjerna ekspresija XAB2 povećava aktivnost promotora CENPE. Cntl: kontrola, OE: prekomjerna ekspresija ( n = 3); * P 0.05. ( b ) Analiza luciferaze koja pokazuje otkazivanje XAB2 smanjuje aktivnost promotora CENPE. ( n = 3); *** P 0, 001. ( c ) Western blot pokazuje učinkovitost prekomjerne ekspresije i obaranja XAB2. ( d ) Analiza luciferaze konstrukcija serijskog brisanja CENPE promotora dovodi do identifikacije jezgre regije CENPE promotora. ( e ) Učinak obrušavanja XAB2 na konstrukcije za brisanje CENPE promotora testom luciferaze ( n = 3); ns, nema značaja, * P 0.05, ** P 0.01, *** P 0.001. ( f ) Analiza ChIP pokazuje da XAB2 surađuje s promotorom CENPE

Slika pune veličine

Da bismo identificirali minimalnu regiju u CENPE promotoru potrebnu za regulaciju XAB2, generirali smo niz konstrukcija za brisanje. Transfekcija ovih konstrukata u HeLa stanice ukazala je da regija -208/92 pokazuje aktivnost luciferaze blizu promotora pune duljine (Slika 6d). Nadalje, regija −1263 / -209 nije imala promotorsku aktivnost (slika 6d), što sugerira da se promotor jezgre proteže oko 300 bp od -208 do 92. Transfekcija konstrukcija za brisanje praćena XAB2 knockdownom pokazala je da ispadanje XAB2 rezultira izrazitim padom u aktivnost luciferaze za promotor pune duljine −1263/92 ili konstrukcije za brisanje −808/92 i −408/92, dok je daljnje brisanje -208/92 dovelo do mnogo manjeg smanjenja, a smanjenje je ukinuto za konstrukciju −58/92 (slika 6e), sugerirajući da je područje između -408 / -59 kritično za transkripcijsku regulaciju CENPE ekspresije pomoću XAB2. Imunoprecipitacija kromatinom (ChIP) proteina XAB2 s oznakom HA također je pokazala značajno obogaćivanje XAB2 na CENPE promotoru (Slika 6f). Sve ove podatke podržavaju da XAB2 transkripcijski regulira ekspresiju CENPE.

Rasprava

XAB2 je komponenta Prp19 kompleksa, za koje se izvješćuje da djeluje u popravku DNA-popravljanju, pre-mRNA spajanju, izvozu mRNA, transkripciji i homolognoj rekombinaciji. U ovom istraživanju izvijestili smo o novoj funkciji XAB2 kao regulatora staničnog ciklusa mitoze.

Da bismo stekli dubinski uvid u utjecaj nedostatka XAB2, napravili smo analizu mikrorasta na ekspresiju gena nakon iscrpljivanja XAB2 u stanicama HeLa. Iznenađujuće, ova analiza otkrila je da se ekspresija mnogih gena koji djeluju u staničnom ciklusu ili u regulaciji mitoze značajno promijenila. Nadalje smo pokazali da je XAB2 nedostatak uzrokovan neusklađivanjem i missegregacijom kromosoma, nenormalnom nuklearnom strukturom, vretenastim polom i organizacijom mikrotubula, što je rezultiralo mitotskim zaustavljanjem, mitotskom katastrofom i kasnijom staničnom smrću, što ukazuje na kritičnu ulogu XAB2 u regulaciji staničnog ciklusa mitotičkih stanica. Naši rezultati su u skladu s fenotipovima XAB2 porušenja dokumentiranim u bazi podataka MITOCHECK (www.mitocheck.org), uključujući kašnjenje metafaze, probleme usklađivanja metafaze i staničnu smrt. 25

Razumijevajući kako XAB2 utječe na mitotski stanični ciklus, pokazalo se da je CENPE jedan od glavnih gena s nevjerojatnom redukcijom ekspresije nakon obaranja XAB2. CENPE je plus krajnji usmjereni motorni protein kinetohora koji pripada poddružini kinezin-7 i detaljno je proučavan. Prvo se regrutuje u kinetohoru tijekom prometne faze, ovisno o proteinima kao što su BubRl, 26 CENPF, 26 NUF2, 27 SEPT7, 28 TRAMM 29 i CTCF, 30, a zatim ih razgrađuje APC / C i SCF na kraju mitoze. 31, 32 CENPE je vrlo veliki protein od oko 312 kDa s više funkcionalnih domena, uključujući N-terminalnu ATP ovisnu motornu domenu, domenu zavojnice zavojnice, domenu koja veže kinetohore na C-terminalu i C-terminalnu vezu mikrotubula domena. 26, 30 Prethodni rad sugerirao je da CENPE igra važnu ulogu u kongresiji kromosoma tijekom prometafaze, 33, 34, formirajući stabilnu vezu između vretenastih mikrotubula i kinetohora od prometafaze do anafaze, 35, 36 i proširenja mikrotubula plus-kraja. 37 Nadalje, CENPE je također bitan za reguliranje SAC-a, vjerojatno modulacijom BubR1 aktivnosti. 38, 39, 40, 41 Spuštanje CENPE primjenom različitih metoda u različitim staničnim vrstama i vrstama dosljedno dovodi do neusklađivanja kromosoma i naknadne odgode mitotske progresije. 33, 34, 38, 40, 42, 43, 44 Međutim, pokazuju različite ćelijske sudbine, od kojih neke izazivaju dugotrajno mitotičko zaustavljanje, 40, 42 a neke rezultiraju missegregacijom kromosoma nakon zastoja mitoze, 38, 43, 44 i neke čak dovodeći do stanične smrti apoptozom. 33

Tako smo testirali mogućnost da XAB2 regulira mitotski stanični ciklus putem CENPE. Doista, potrošnja XAB2 dovela je do dramatičnog smanjenja CENPE i na razini mRNA i proteina. Sukladno ranijim izvješćima, iscrpljivanje CENPE-a rezultiralo je sličnim fenotipovima kao što je uočeno za XAB2 knockdown, uključujući kromosomsko neslaganje i mitotičko zaustavljanje. Nadalje, knockdown CENPE praćen XAB2 shRNA tretmanom nije promijenio G2 / M zastoj uzrokovan CENPE. Ovi rezultati sugeriraju da XAB2 djeluje uzvodno od CENPE i može regulirati napredovanje mitotičkog staničnog ciklusa putem CENPE.

Nadalje smo pokazali da se XAB2 veže za promotor CENPE i regulira njegovu ekspresiju primjenom ChIP i luciferaraznog testa. Prekomjerna ekspresija XAB2 dovela je do veće aktivnosti luciferaze dok je iscrpljivanje XAB2 rezultiralo u snažnom smanjenju aktivnosti luciferaze. Prethodno izvješće pokazalo je da XAB2 djeluje u interakciji s RNA polimerazom II i ima ulogu u transkripciji, uglavnom modulacijom produženja transkripcije. 6, 10 Budući da se XAB2 kompleks (hAquarius, XAB2, Prp19, CCDC16, hISY1 i PPIE) vezuje za RNA, ali ne i DNA in vitro, a XAB2 sadrži 15 tetratrikopeptidnih ponavljajućih motiva koji su uključeni u interakcije protein-protein, ali bez domena koji vežu DNA, vrlo je vjerojatno da je XAB2 regrutiran za promotor CENPE od strane drugih proteina.

Međutim, u eksperimentu spašavanja CENPE nismo primijetili značajnu obnovu zaustavljanja staničnog ciklusa kada je CENPE ponovno izražen nakon iscrpljivanja XAB2 (podaci nisu prikazani). Intrigantno, ponovno izražavanje CENPE-a nakon vlastitog rušenja u stanicama Hela nije moglo zaustaviti ni zaustavljanje staničnog ciklusa (podaci nisu prikazani). Moguće objašnjenje ovih opažanja može uključivati ​​da razina prekomjerne ekspresije nije dovoljno visoka da nadoknadi iscrpljivanje zbog velike molekulske mase CENPE (312 kDa) ili je fenotip izazvan manjkom CENPE ozbiljan i nepovratan. Pored toga, ne možemo isključiti mogućnost da učinak iscrpljivanja XAB2 posreduje defektima u višestrukim genima, što je otkriveno mikroarrijskom analizom da je podskup gena uključenih u stanični ciklus i mitotsku progresiju dolje reguliran.

Mitoza je jedan od kritičnih procesa u staničnom ciklusu za pravilnu segregaciju kromosoma tijekom stanične diobe. Disregulacija mitoze često uzrokuje nestabilnost ili aneuploidiju genoma, dovodi do mitotske katastrofe i stanične smrti, a usko je povezana s karcinomom i mnogim drugim bolestima. Stoga je ciljanje mitoze predloženo kao atraktivna terapijska strategija za terapiju raka, na primjer, 45, 46, CENPE inhibitor poput GSK923295, 47 sintelina 48 ili PF2721 49 smatra se da ima antitumorsko djelovanje. Stoga će biti zanimljivo istražiti može li XAB2 poslužiti kao nova antititotička meta za liječenje raka.

Materijali i metode

Konstrukcije i antitijela

Konstrukt XAB2 kupljen je od Origene-a i ponovno je kloniran u modificirani pcDNA3.1 vektor (Promega, USA) koji sadrži HA oznaku na 5 ′ kraju. Ulomak od 1355 bp od 5 'sekvence regije koji se proteže od -1263 do 92 (+1 je mjesto početka transkripcije) humanog CENPE gena amplificirano je PCR-om iz helanske DNK gena i klonirano u vektor pGL3-Basic (Promega) na KpnI / HindIII stranice. Izbrisani konstrukti CENPE promotora amplificirani su iz konstrukcije promotora pune duljine koristeći ugniježđeni PCR. Slijed svih konstrukata potvrđen je izravnim sekvenciranjem. Sekvence temeljnih premaza navedene su u Dodatnoj tablici 2.

Poliklonalno antitijelo protiv XAB2 (Proteintech, Wuhan, Kina, 1: 800), fosfo-histon H3 (Ser10) (CST, MA, SAD, 1: 1000), Cdc2 (CST, 1: 2000), Histon H2A.X (Proteintech, 1: 1000), fosfo-histon H2A.X ( γ- H2A.X) (CST, 1: 800), monoklonska antitijela protiv oznake HA (Covance, MA, USA, 1: 2000), CyclinB1 (CST, 1: 2000), CENPE (Abcam, MA, USA, 1: 1000), i α -tubulin (Sigma, Njemačka, 1: 5000) korišteni su u zapadnom blotu.

Stanična kultura i RNA smetnje

HeLa i 293T ćelije poklon su od laboratorija Reed u Medicinskom fakultetu na Harvardu, stanice MDA-MB-231 kupljene su iz američke zbirke kultura tipova (Manassas, VA, SAD). Sve su stanice uzgajane u dulbeccovom modificiranom mediju orla uz dodatak 10% fetalnog goveđeg seruma.

Za spuštanje gena posredovano siRNA, stanice su stavljene u pločicu sa šest jažica i 2 μl siRNA na 50 µM transficirana je pomoću lipofektamina 3000. Stanice su nakon transfekcije tretirane s CENPE siRNA ili XAB2 siRNA za analizu 24, odnosno 55 h. Prethodno su prijavljeni CENPE siRNA i XAB2 siRNA, 22, 50 neciljana siRNA (RiboBio, Kina) korištena je kao negativna kontrola. SiRNA sekvence su sljedeće: CENPE siRNA (5′-CCACUAGAGUUGAAAGAUAdTdT-3 ′), XAB2-siRNA-1 (5′-CCAAUUCUCUGUCUCAAUGCdTdT-3 ′), XAB2-siRNA-2 (5′-ACCCUCUTUCCUTUCUCTUCUCTUCUCTUCUCTUCUCTUCUCTUCUCTUCUCTUCUCTUCUCTUCUCUCTUCCUTUCUCUCUT)

Za srušavanje gena posredovanog shRNA, proizvedeni su lentivirusi koji eksprimiraju XAB2 shRNA kako slijedi: 293T stanice stavljene su u 6 cm posudu i kotransficirane s 1, 4 μg XAB2 shRNA (klonirano u PLKO.1), 1, 4 μg pREV, 1, 4 μg pGag / Pol / PRE i 0, 7 μg pVSVG. Za kontrolu, zamijenite XAB2 shRNA konstrukciju s kontrolnim vektorom. Šest sati nakon transfekcije, smjesu je zamijenio svježi dulbeccovi modificirani orao, koji je sadržavao 10% FBS-a, a stanice su uzgajane dodatnih 48 sati. Potom je medij koji sadrži lentiviruse filtrirao i čuvao na -80 ° C. Što se tiče infekcije lentivirusom, stanice uzgajane u pločici sa šest jažica bile su zaražene dva puta lentivirusom koji sadrži 6 μg / ml polibrena, ukupno 48 sati. Za mikrorezu, Western blot, imunofluorescenciju, RT-PCR i analizu raspodjele staničnog ciklusa, stanice su sakupljene nakon uzgoja u svježem mediju još 24 sata. Za analizu stanične smrti, stanice su sakupljene 48 sati kasnije. The full sequence of XAB2 shRNA-1 and XAB2 shRNA-2 are CCGGGCTTCGCTACATCGAGTTCAACTCGAGTTGAACTCGATGTAGCGAAGCTTTTTG and CCGGGCAGTATGACATGTTCAACATCTCGAGATGTTGAACATGTCATACTGCTTTTTG, respectively. XAB2 shRNA-1 was used in the XAB2 knockdown experiments in this study unless otherwise indicated.

Microarray gene expression analysis

Hela cells were plated in six-well plate and infected twice with control or XAB2 shRNA lentivirus. Then cells were harvested and total RNA was isolated using RNeasy plus kit (Qiagen, Germany) following the manufacturer's instruction. The integrity of total RNA was monitored with Agilent 2100 Bioanalyzer. Microarrays were performed using Human Transcriptome Array 2.0 (Affymetrix, USA) with three independent experiments. Results were analysed by using the Transcriptome Analysis Console from Affymetrix. Only genes that had a 2-fold increase or decrease in expression with a significance of P <0.05 were included in the final results. Functional analysis of the genes with expression significantly changed by XAB2 knockdown was performed using Gene Ontology analysis.

FACS analysis

To examine the cell cycle distribution, cells were harvested and fixed in 75% ethanol at 4 °C overnight, washed twice with PBS, and then incubated with PI (Sigma) solution containing RNase for 30 min. The flow cytometry analysis was conducted on ACCURIC6, and the data were analysed using FlowJo7.6 software.

For cell death analysis, cells were stained using annexin/PI staining kit (KeyGEN BioTECH, Nanjing, China) for detection according to the manufacturer's instructions.

To detect the fraction of phospho-Histone H3 Ser10 positive cells, cells were fixed by 75% ethanol, permeabilized by 0.25% Triton X-100, and then stained with Alexa Fluor488-conjugated phospho-Histone H3 Ser10 antibody (1:50, CST) and PI.

imunofluorescencija

Cells were grown in 35 mm cell culture dish with glass bottom (NEST, Wuxi, China), fixed with 4% paraformaldehyde (Sigma, Germany) for 30 min, followed by permeabilization with 0.5% Triton X-100 for 10 min at room temperature. Cells were then incubated with α -tubulin antibody (1:250) diluted in PBS with 10% calf serum at 4 °C overnight, and immunostained with Alexa 488-labeled anti-mouse antibody (1:500) diluted in the same buffer at room temperature for 30 min, followed by DAPI staining and four washes with PBS for 5 min each. Fluorescence was detected using DMI6000 microscope (Leica, Germany).

Live cell imaging

GFP-H2B HeLa cells were a gift from Dr Huiyan Li in China National Center of Biomedical Analysis and were placed in 35 mm cell culture dish with glass bottom (NEST). Twenty-four hours after second infection with control or XAB2 shRNA lentivirus, images were captured every 10 min for 48 h using DMI6000 microscope (Leica) equipped with a × 40 objective lens in a chamber maintained at 37 °C with 5% CO 2 .

Transfection and luciferase assay

Cells were seeded into 12-well plate the day before transfection. 1 μg of firefly luciferase constructs were transfected using lipofectamine 2000. The pRL-TK plasmid (100 ng/sample) encoding Renilla luciferase was cotransfected, and the readout was used for normalization of firefly luciferase activity. Cells were harvested 24 h after transfection and luciferase activity was measured with Dual-Luciferase Reporter Assay Kit (Promega). All transfections were performed in triplicate.

To assess the effect of XAB2 overexpression or knockdown on CENPE promoter activity, Hela cells in 12-well plates were transfected with XAB2 construct for 24 h or infected twice with lentivirus containing XAB2 shRNA, followed by co-transfection of CENPE promoter construct and pRL-TK vector, cells were then harvested after 24 h for the measurement of luciferase activity.

ChIP

The ChIP assay was performed using EpiQuik Chromatin Immunoprecipitation Kit from Epigentek Group Inc. (Brooklyn, NY, USA) according to the manufacturer's protocol. Protein-DNA complexes were immunoprecipitated with HA antibody, and normal mouse IgG was used as negative control. Primer sets for CENPE were shown in Supplementary Table 2.

statistika

Data were presented as mean±sd (standard deviation). Statistical analyses between two groups were performed using Student's t -test with statistical significance defined as * P <0.05, ** P <0.01 and *** P <0.001.

Dodatna informacija

PDF datoteke

  1. 1.

    Dopunska slika S1

  2. 2.

    Dopunska slika S2

  3. 3.

    Dopunska slika S3

  4. 4.

    Dopunska tablica S1

  5. 5.

    Dopunska tablica S2

Glosar

XPA

xeroderma pigmentosum group A

XAB2

XPA-binding protein 2

CSA

Cockayne syndrome group A

ATRA

all-trans retinoic acid

CENPE

centrosome-associated protein E

FACS

fluorescence-activated cell scanner

γ -H2A.X

Phospho-Histone H2A.X

ChIP

chromatin immunoprecipitation

SD

standard deviation

Dodatne informacije nalaze se u ovom radu na web stranici Cell Death and Disease (//www.nature.com/cddis)